Regulog LexA - Comamonadaceae
| Regulator type: | Transcription factor |
| Regulator family: | LexA |
| Regulation mode: | repressor |
| Biological process: | SOS response |
| Effector: | DNA damage |
| Phylum: | Proteobacteria/beta |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Comamonadaceae
- By trascription factor - LexA
- By TF family - LexA
- By effector - DNA damage
- By pathway - SOS response
| Genome | Genes | Operons |
|---|---|---|
| Acidovorax avenae subsp. citrulli AAC00-1 | 18 | 8 |
| Acidovorax sp. JS42 | 12 | 6 |
| Comamonas testosteroni KF-1 | 11 | 5 |
| Delftia acidovorans SPH-1 | 9 | 5 |
| Polaromonas naphthalenivorans CJ2 | 9 | 4 |
| Polaromonas sp. JS666 | 13 | 7 |
| Rhodoferax ferrireducens DSM 15236 | 11 | 6 |
| Variovorax paradoxus S110 | 12 | 6 |
| Verminephrobacter eiseniae EF01-2 | 3 | 3 |
| Methylibium petroleiphilum PM1 | 14 | 8 |
| Leptothrix cholodnii SP-6 | 7 | 4 |
| Genes | Function | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||||
| PF04055 |
*
Acidovorax avenae subsp. citrulli AAC00-1 Site: position = -42 score = 6.10062 sequence = AACTGTATATTCATACAGTT Gene: Aave_2176: DNA repair photolyase |
*
Acidovorax sp. JS42 Site: position = -23 score = 4.94001 sequence = TGCTGGATGAAATCACAGTA Gene: Ajs_2803: DNA repair photolyase |
|
*
Delftia acidovorans SPH-1 Site: position = 2 score = 5.55607 sequence = GACTGTATTTTTATACAGTT Gene: Daci_2403: DNA repair photolyase |
|
*
Polaromonas sp. JS666 Site: position = -137 score = 5.29311 sequence = AACTGGGTATTTATCCAGTA Gene: Bpro_3135: DNA repair photolyase |
|
*
Variovorax paradoxus S110 Site: position = -40 score = 5.86341 sequence = TACTGTGTAAACATACAGTA Gene: Vapar_1693: DNA repair photolyase |
|
*
Methylibium petroleiphilum PM1 Site: position = -33 score = 6.03826 sequence = TACTGTACAAAAATACAGTA Gene: Mpe_A2509: DNA repair photolyase |
*
Leptothrix cholodnii SP-6 Site: position = -39 score = 5.13262 sequence = AACTGTATGCGCATACAGTT Gene: Lcho_2079: DNA repair photolyase |
DNA repair photolyase |
| CRON 2. | ||||||||||||
| umuD |
|
|
|
|
|
*
Polaromonas sp. JS666 Site: position = -10 score = 5.61772 sequence = TACTGGATGGATGTACAGTA Gene: Bpro_4982: DNA polymerase V, subunit UmuD |
*
Rhodoferax ferrireducens DSM 15236 Site: position = -10 score = 5.04356 sequence = TACTGTATGGATGATCAGTA Gene: Rfer_4342: DNA polymerase V, subunit UmuD |
|
|
*
Methylibium petroleiphilum PM1 Site: position = -55 score = 5.33417 sequence = TACTGTATGGATGTACAGCA Gene: Mpe_B0048: DNA polymerase V, subunit UmuD |
|
DNA polymerase V, subunit UmuD |
| umuC |
|
|
|
|
Gene: Pnap_4268: DNA polymerase V, subunit UmuC |
Gene: Bpro_4983: DNA polymerase V, subunit UmuC |
Gene: Rfer_4341: DNA polymerase V, subunit UmuC |
|
|
*
Methylibium petroleiphilum PM1 Site: position = -6 score = 5.80485 sequence = TACTGTATGTCCATACAGTA Gene: Mpe_B0052: DNA polymerase V, subunit UmuC |
|
DNA polymerase V, subunit UmuC |
| CRON 3. | ||||||||||||
| parE |
*
Acidovorax avenae subsp. citrulli AAC00-1 Site: position = -52 score = 4.08323 sequence = GGCTGTCTTTCCATCCAGTA Gene: Aave_1340: Topoisomerase IV subunit B (EC 5.99.1.-) |
*
Acidovorax sp. JS42 Site: position = -35 score = 4.52777 sequence = TCCTGGTTTTATATCCAGCA Gene: Ajs_1014: Topoisomerase IV subunit B (EC 5.99.1.-) |
*
Comamonas testosteroni KF-1 Site: position = -52 score = 4.38915 sequence = AACTGTGAATTTATCCAGCT Gene: CtesDRAFT_5182: Topoisomerase IV subunit B (EC 5.99.1.-) |
Gene: Daci_5085: Topoisomerase IV subunit B (EC 5.99.1.-) |
*
Polaromonas naphthalenivorans CJ2 Site: position = -64 score = 5.44231 sequence = AACTGTATGTTTGTACAGGT Gene: Pnap_1199: Topoisomerase IV subunit B (EC 5.99.1.-) |
*
Polaromonas sp. JS666 Site: position = -114 score = 5.29311 sequence = AACTGGGTATTTATCCAGTA Gene: Bpro_3165: Topoisomerase IV subunit B (EC 5.99.1.-) |
*
Rhodoferax ferrireducens DSM 15236 Site: position = -38 score = 4.15904 sequence = AGCTGTGCTTTCATACAGCC Gene: Rfer_2642: Topoisomerase IV subunit B (EC 5.99.1.-) |
Gene: Vapar_3428: Topoisomerase IV subunit B (EC 5.99.1.-) |
*
Verminephrobacter eiseniae EF01-2 Site: position = -52 score = 5.0162 sequence = AACTGTTTTTTTATCCAGCT Gene: Veis_1664: Topoisomerase IV subunit B (EC 5.99.1.-) |
Gene: Mpe_A2559: Topoisomerase IV subunit B (EC 5.99.1.-) |
Gene: Lcho_2635: Topoisomerase IV subunit B (EC 5.99.1.-) |
Topoisomerase IV subunit B (EC 5.99.1.-) |
| yjbJ |
2
Acidovorax avenae subsp. citrulli AAC00-1 Gene: Aave_0476: Conserved hypothetical protein, similar to lytic transglycosylase Gene: Aave_1341: Conserved hypothetical protein, similar to lytic transglycosylase |
Gene: Ajs_1015: Conserved hypothetical protein, similar to lytic transglycosylase |
Gene: CtesDRAFT_5183: Conserved hypothetical protein, similar to lytic transglycosylase |
Gene: Daci_5084: Conserved hypothetical protein, similar to lytic transglycosylase |
Gene: Pnap_1200: Conserved hypothetical protein, similar to lytic transglycosylase |
Gene: Bpro_3164: Conserved hypothetical protein, similar to lytic transglycosylase |
|
Gene: Vapar_3427: Conserved hypothetical protein, similar to lytic transglycosylase |
|
|
|
Conserved hypothetical protein, similar to lytic transglycosylase |
| parC |
Gene: Aave_1342: Topoisomerase IV subunit A (EC 5.99.1.-) |
Gene: Ajs_1016: Topoisomerase IV subunit A (EC 5.99.1.-) |
Gene: CtesDRAFT_5184: Topoisomerase IV subunit A (EC 5.99.1.-) |
Gene: Daci_5083: Topoisomerase IV subunit A (EC 5.99.1.-) |
Gene: Pnap_1201: Topoisomerase IV subunit A (EC 5.99.1.-) |
Gene: Bpro_3163: Topoisomerase IV subunit A (EC 5.99.1.-) |
Gene: Rfer_2641: Topoisomerase IV subunit A (EC 5.99.1.-) |
Gene: Vapar_3425: Topoisomerase IV subunit A (EC 5.99.1.-) |
Gene: Veis_0399: Topoisomerase IV subunit A (EC 5.99.1.-) |
Gene: Mpe_A2558: Topoisomerase IV subunit A (EC 5.99.1.-) |
Gene: Lcho_2632: Topoisomerase IV subunit A (EC 5.99.1.-) |
Topoisomerase IV subunit A (EC 5.99.1.-) |
| CRON 4. | ||||||||||||
| imuA |
*3
Acidovorax avenae subsp. citrulli AAC00-1 Site: position = -34 score = 5.37367 sequence = TGCTGTATATTTGAACAGTA Gene: Aave_2670: Predicted RecA/RadA recombinase Site: position = -49 score = 5.88406 sequence = TACTGTTTATTCATACAGTG Gene: Aave_0516: Predicted RecA/RadA recombinase Site: position = -43 score = 5.70279 sequence = TACTGTATAAATAATCAGTA Gene: Aave_2734: Predicted RecA/RadA recombinase |
*
Acidovorax sp. JS42 Site: position = -85 score = 4.94001 sequence = TGCTGGATGAAATCACAGTA Gene: Ajs_1965: Predicted RecA/RadA recombinase |
*
Comamonas testosteroni KF-1 Site: position = -35 score = 5.6394 sequence = GACTGTATATTTGTACAGTA Gene: CtesDRAFT_1921: Predicted RecA/RadA recombinase |
*
Delftia acidovorans SPH-1 Site: position = -35 score = 5.84987 sequence = TGCTGTATATTCATACAGTA Gene: Daci_4263: Predicted RecA/RadA recombinase |
*
Polaromonas naphthalenivorans CJ2 Site: position = -33 score = 6.03388 sequence = TACTGGTTATTCATACAGTA Gene: Pnap_4894: Predicted RecA/RadA recombinase |
*
Polaromonas sp. JS666 Site: position = -56 score = 6.01672 sequence = TACTGTACATAAATACAGTA Gene: Bpro_2386: Predicted RecA/RadA recombinase |
*
Rhodoferax ferrireducens DSM 15236 Site: position = -48 score = 5.30853 sequence = TACTGTTGTTTTATACAGTT Gene: Rfer_1225: Predicted RecA/RadA recombinase |
*2
Variovorax paradoxus S110 Site: position = -32 score = 6.38076 sequence = TACTGTATAAAAATACAGTT Gene: Vapar_3206: Predicted RecA/RadA recombinase Site: position = -32 score = 5.52893 sequence = TACTGTTCATCCATACAGTA Gene: Vapar_4538: Predicted RecA/RadA recombinase |
|
*2
Methylibium petroleiphilum PM1 Site: position = -133 score = 5.2215 sequence = TACTGTATGCCCATACAGTC Gene: Mpe_B0617: Predicted RecA/RadA recombinase Site: position = -44 score = 5.74657 sequence = TACTGTATTTATGTACAGTA Gene: Mpe_A1534: Predicted RecA/RadA recombinase |
*
Leptothrix cholodnii SP-6 Site: position = -32 score = 5.56293 sequence = GACTGTATGAACATACAGTC Gene: Lcho_2901: Predicted RecA/RadA recombinase |
Predicted RecA/RadA recombinase |
| imuB |
3
Acidovorax avenae subsp. citrulli AAC00-1 Gene: Aave_2671: DNA polymerase-like protein PA0670 Gene: Aave_0517: DNA polymerase-like protein PA0670 Gene: Aave_2733: DNA polymerase-like protein PA0670 |
Gene: Ajs_1966: DNA polymerase-like protein PA0670 |
Gene: CtesDRAFT_1920: DNA polymerase-like protein PA0670 |
Gene: Daci_4262: DNA polymerase-like protein PA0670 |
Gene: Pnap_4895: DNA polymerase-like protein PA0670 |
Gene: Bpro_2387: DNA polymerase-like protein PA0670 |
Gene: Rfer_1226: DNA polymerase-like protein PA0670 |
2
Variovorax paradoxus S110 Gene: Vapar_3205: DNA polymerase-like protein PA0670 Gene: Vapar_4537: DNA polymerase-like protein PA0670 |
|
2
Methylibium petroleiphilum PM1 Gene: Mpe_B0618: DNA polymerase-like protein PA0670 Gene: Mpe_A1533: DNA polymerase-like protein PA0670 |
Gene: Lcho_2902: DNA polymerase-like protein PA0670 |
DNA polymerase-like protein PA0670 |
| dnaE2 |
3
Acidovorax avenae subsp. citrulli AAC00-1 Gene: Aave_2672: DNA polymerase III alpha subunit (EC 2.7.7.7) Gene: Aave_0518: DNA polymerase III alpha subunit (EC 2.7.7.7) Gene: Aave_2732: DNA polymerase III alpha subunit (EC 2.7.7.7) |
Gene: Ajs_1967: DNA polymerase III alpha subunit (EC 2.7.7.7) |
Gene: CtesDRAFT_1919: DNA polymerase III alpha subunit (EC 2.7.7.7) |
Gene: Daci_4261: DNA polymerase III alpha subunit (EC 2.7.7.7) |
Gene: Pnap_4896: DNA polymerase III alpha subunit (EC 2.7.7.7) |
Gene: Bpro_2388: DNA polymerase III alpha subunit (EC 2.7.7.7) |
Gene: Rfer_1227: DNA polymerase III alpha subunit (EC 2.7.7.7) |
2
Variovorax paradoxus S110 Gene: Vapar_3204: DNA polymerase III alpha subunit (EC 2.7.7.7) Gene: Vapar_4536: DNA polymerase III alpha subunit (EC 2.7.7.7) |
|
2
Methylibium petroleiphilum PM1 Gene: Mpe_B0619: DNA polymerase III alpha subunit (EC 2.7.7.7) Gene: Mpe_A1532: DNA polymerase III alpha subunit (EC 2.7.7.7) |
Gene: Lcho_2903: DNA polymerase III alpha subunit (EC 2.7.7.7) |
DNA polymerase III alpha subunit (EC 2.7.7.7) |
| Aave_0184 |
*
Acidovorax avenae subsp. citrulli AAC00-1 Site: position = -33 score = 4.75125 sequence = CACTGTATTTACAATCAGTG Gene: Aave_0184: Conserved hypothetical protein |
|
|
|
Gene: Pnap_1706: Conserved hypothetical protein |
Gene: Bpro_2305: Conserved hypothetical protein |
|
Gene: Vapar_3203: Conserved hypothetical protein |
|
*
Methylibium petroleiphilum PM1 Site: position = -49 score = 5.43999 sequence = TACTGTATTTACGAACAGTA Gene: Mpe_A0910: Conserved hypothetical protein |
Gene: Lcho_0308: Conserved hypothetical protein |
Conserved hypothetical protein |
| PF06733 |
Gene: Aave_0185: DinG family ATP-dependent helicase CPE1197 |
Gene: Ajs_2428: DinG family ATP-dependent helicase CPE1197 |
Gene: CtesDRAFT_1894: DinG family ATP-dependent helicase CPE1197 |
Gene: Daci_5813: DinG family ATP-dependent helicase CPE1197 |
|
Gene: Bpro_1361: DinG family ATP-dependent helicase CPE1197 |
|
*
Variovorax paradoxus S110 Site: position = -26 score = 4.9962 sequence = TACTGTTGTTTTATACAGCA Gene: Vapar_2806: DinG family ATP-dependent helicase CPE1197 |
|
Gene: Mpe_A0909: DinG family ATP-dependent helicase CPE1197 |
|
DinG family ATP-dependent helicase CPE1197 |
| PF08774 |
|
*
Acidovorax sp. JS42 Site: position = -75 score = 4.94001 sequence = TGCTGGATGAAATCACAGTA Gene: Ajs_2429: Hypothetical protein, restriction endonuclease-like VRR-NUC domain |
*
Comamonas testosteroni KF-1 Site: position = -6 score = 5.55904 sequence = AGCTGTATGAAAATACAGGT Gene: CtesDRAFT_1895: Hypothetical protein, restriction endonuclease-like VRR-NUC domain |
*
Delftia acidovorans SPH-1 Site: position = -54 score = 5.55406 sequence = GACTGTATAAAGATACAGTT Gene: Daci_5814: Hypothetical protein, restriction endonuclease-like VRR-NUC domain |
|
|
|
|
|
|
|
Hypothetical protein, restriction endonuclease-like VRR-NUC domain |
| CRON 5. | ||||||||||||
| recA |
*
Acidovorax avenae subsp. citrulli AAC00-1 Site: position = -98 score = 4.30784 sequence = TACTGGTCAAGCATCCAGCC Gene: Aave_4640: Recombinase A |
*
Acidovorax sp. JS42 Site: position = -87 score = 4.34851 sequence = TACTGTTCAAGCATCCAGCC Gene: Ajs_4001: Recombinase A |
*
Comamonas testosteroni KF-1 Site: position = -76 score = 4.34851 sequence = TACTGTTCAAGCATCCAGCC Gene: CtesDRAFT_3877: Recombinase A |
*
Delftia acidovorans SPH-1 Site: position = -66 score = 4.34851 sequence = TACTGTTCAAGCATCCAGCC Gene: Daci_0874: Recombinase A |
*
Polaromonas naphthalenivorans CJ2 Site: position = -102 score = 4.41396 sequence = TACTGTTCATGCACCCAGTA Gene: Pnap_3956: Recombinase A |
*
Polaromonas sp. JS666 Site: position = -146 score = 4.19855 sequence = AACTGACTAAAAATAGGGTT Gene: Bpro_4685: Recombinase A |
*
Rhodoferax ferrireducens DSM 15236 Site: position = -38 score = 4.34851 sequence = TACTGTTCAAGCATCCAGCC Gene: Rfer_3948: Recombinase A |
*
Variovorax paradoxus S110 Site: position = -83 score = 4.34851 sequence = TACTGTTCAAGCATCCAGCC Gene: Vapar_5195: Recombinase A |
*
Verminephrobacter eiseniae EF01-2 Site: position = -47 score = 4.56632 sequence = TACTGTTCAAGCATCCAGCT Gene: Veis_0355: Recombinase A |
*
Methylibium petroleiphilum PM1 Site: position = -54 score = 5.28555 sequence = TACTGTACAAATAACCAGTT Gene: Mpe_A0075: Recombinase A |
*
Leptothrix cholodnii SP-6 Site: position = -56 score = 4.81607 sequence = CACTGTACAAACATCCAGCA Gene: Lcho_0497: Recombinase A |
Recombinase A |
| recX |
Gene: Aave_4641: Regulatory protein RecX |
Gene: Ajs_4002: Regulatory protein RecX |
Gene: CtesDRAFT_3876: Regulatory protein RecX |
Gene: Daci_0873: Regulatory protein RecX |
Gene: Pnap_3955: Regulatory protein RecX |
Gene: Bpro_4684: Regulatory protein RecX |
Gene: Rfer_3947: Regulatory protein RecX |
Gene: Vapar_5194: Regulatory protein RecX |
|
Gene: Mpe_A0074: Regulatory protein RecX |
Gene: Lcho_0496: Regulatory protein RecX |
Regulatory protein RecX |
| CRON 6. | ||||||||||||
| radA |
Gene: Aave_0262: DNA repair protein RadA |
Gene: Ajs_0180: DNA repair protein RadA |
Gene: CtesDRAFT_3997: DNA repair protein RadA |
Gene: Daci_0314: DNA repair protein RadA |
Gene: Pnap_0138: DNA repair protein RadA |
*
Polaromonas sp. JS666 Site: position = -30 score = 5.66058 sequence = TACTGGTTGTTTGTACAGTA Gene: Bpro_0200: DNA repair protein RadA |
*2
Rhodoferax ferrireducens DSM 15236 Site: position = -31 score = 4.91177 sequence = ATCTGTTTTTCCATACAGTA Gene: Rfer_0500: DNA repair protein RadA Gene: Rfer_4298: DNA repair protein RadA |
Gene: Vapar_0251: DNA repair protein RadA |
Gene: Veis_0797: DNA repair protein RadA |
Gene: Mpe_A3556: DNA repair protein RadA |
Gene: Lcho_0917: DNA repair protein RadA |
DNA repair protein RadA |
| CRON 7. | ||||||||||||
| lexA |
*
Acidovorax avenae subsp. citrulli AAC00-1 Site: position = -95 score = 6.0591 sequence = AACTGTTTAAAAATACAGTG Gene: Aave_2558: SOS-response repressor and protease LexA (EC 3.4.21.88) |
*
Acidovorax sp. JS42 Site: position = -54 score = 5.76961 sequence = TACTGGATTAAAAAACAGTA Site: position = -73 score = 5.50813 sequence = AACTGTTCAAAAATACAGAT Gene: Ajs_2310: SOS-response repressor and protease LexA (EC 3.4.21.88) |
*
Comamonas testosteroni KF-1 Site: position = -67 score = 5.63136 sequence = AACTGATTAAAAATACAGGT Site: position = -48 score = 5.60636 sequence = TACTGGATGAACACACAGTA Gene: CtesDRAFT_1157: SOS-response repressor and protease LexA (EC 3.4.21.88) |
*
Delftia acidovorans SPH-1 Site: position = -64 score = 4.72465 sequence = TACTGTATAAATCATCAGAT Site: position = -83 score = 5.82185 sequence = AACTGGTTAAAAATACAGAT Gene: Daci_3565: SOS-response repressor and protease LexA (EC 3.4.21.88) |
*
Polaromonas naphthalenivorans CJ2 Site: position = -84 score = 5.8947 sequence = TACTGGATATTCATACAGTC Site: position = -103 score = 5.54611 sequence = AGCTGTATAAAAATGCAGTT Gene: Pnap_1918: SOS-response repressor and protease LexA (EC 3.4.21.88) |
*
Polaromonas sp. JS666 Site: position = -96 score = 5.66533 sequence = TACTGGATATTAAAACAGGT Site: position = -115 score = 6.11857 sequence = AACTGGATGAAAATACAGTT Gene: Bpro_2954: SOS-response repressor and protease LexA (EC 3.4.21.88) |
*
Rhodoferax ferrireducens DSM 15236 Site: position = -65 score = 4.64268 sequence = TACTGAATACAACAACAGTG Site: position = -84 score = 5.91638 sequence = AACTGATTAAAAATACAGTT Gene: Rfer_2994: SOS-response repressor and protease LexA (EC 3.4.21.88) |
*
Variovorax paradoxus S110 Site: position = -36 score = 4.94289 sequence = TACTGGATATTCAGCCAGTG Site: position = -55 score = 5.91202 sequence = AACTGGTTAAAAATACAGGT Gene: Vapar_2636: SOS-response repressor and protease LexA (EC 3.4.21.88) |
*
Verminephrobacter eiseniae EF01-2 Site: position = -56 score = 5.5065 sequence = TACTGGATTGAAAAACAGTT Site: position = -75 score = 5.87282 sequence = AACTGGTTAAAAATACAGCT Gene: Veis_4912: SOS-response repressor and protease LexA (EC 3.4.21.88) |
*
Methylibium petroleiphilum PM1 Site: position = -67 score = 5.42422 sequence = CACTGGATAAAAATTCAGTG Site: position = -86 score = 5.75456 sequence = AGCTGGATAAAAATACAGTC Gene: Mpe_A1866: SOS-response repressor and protease LexA (EC 3.4.21.88) |
*
Leptothrix cholodnii SP-6 Site: position = -110 score = 5.37926 sequence = GACTGGATAAAATTACAGTG Gene: Lcho_2082: SOS-response repressor and protease LexA (EC 3.4.21.88) |
SOS-response repressor and protease LexA (EC 3.4.21.88) |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |