Regulog LexA - Comamonadaceae

Properties
Regulator type:	Transcription factor
Regulator family:	LexA
Regulation mode:	repressor
Biological process:	SOS response
Effector:	DNA damage
Phylum:	Proteobacteria/beta
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 71 sites [see more]

Member of regulog collections

By taxonomy - Comamonadaceae
By trascription factor - LexA
By TF family - LexA
By effector - DNA damage
By pathway - SOS response

Statistics of regulated genes
Genome	Genes	Operons
Acidovorax avenae subsp. citrulli AAC00-1	18	8
Acidovorax sp. JS42	12	6
Comamonas testosteroni KF-1	11	5
Delftia acidovorans SPH-1	9	5
Polaromonas naphthalenivorans CJ2	9	4
Polaromonas sp. JS666	13	7
Rhodoferax ferrireducens DSM 15236	11	6
Variovorax paradoxus S110	12	6
Verminephrobacter eiseniae EF01-2	3	3
Methylibium petroleiphilum PM1	14	8
Leptothrix cholodnii SP-6	7	4

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes												Function

CRON 1.
PF04055	* Acidovorax avenae subsp. citrulli AAC00-1 Site: position = -42 score = 6.10062 sequence = AACTGTATATTCATACAGTT Gene: Aave_2176: DNA repair photolyase	* Acidovorax sp. JS42 Site: position = -23 score = 4.94001 sequence = TGCTGGATGAAATCACAGTA Gene: Ajs_2803: DNA repair photolyase	Comamonas testosteroni KF-1	* Delftia acidovorans SPH-1 Site: position = 2 score = 5.55607 sequence = GACTGTATTTTTATACAGTT Gene: Daci_2403: DNA repair photolyase	Polaromonas naphthalenivorans CJ2	* Polaromonas sp. JS666 Site: position = -137 score = 5.29311 sequence = AACTGGGTATTTATCCAGTA Gene: Bpro_3135: DNA repair photolyase	Rhodoferax ferrireducens DSM 15236	* Variovorax paradoxus S110 Site: position = -40 score = 5.86341 sequence = TACTGTGTAAACATACAGTA Gene: Vapar_1693: DNA repair photolyase	Verminephrobacter eiseniae EF01-2	* Methylibium petroleiphilum PM1 Site: position = -33 score = 6.03826 sequence = TACTGTACAAAAATACAGTA Gene: Mpe_A2509: DNA repair photolyase	* Leptothrix cholodnii SP-6 Site: position = -39 score = 5.13262 sequence = AACTGTATGCGCATACAGTT Gene: Lcho_2079: DNA repair photolyase	DNA repair photolyase

CRON 2.
umuD	Acidovorax avenae subsp. citrulli AAC00-1	Acidovorax sp. JS42	Comamonas testosteroni KF-1	Delftia acidovorans SPH-1	Polaromonas naphthalenivorans CJ2	* Polaromonas sp. JS666 Site: position = -10 score = 5.61772 sequence = TACTGGATGGATGTACAGTA Gene: Bpro_4982: DNA polymerase V, subunit UmuD	* Rhodoferax ferrireducens DSM 15236 Site: position = -10 score = 5.04356 sequence = TACTGTATGGATGATCAGTA Gene: Rfer_4342: DNA polymerase V, subunit UmuD	Variovorax paradoxus S110	Verminephrobacter eiseniae EF01-2	* Methylibium petroleiphilum PM1 Site: position = -55 score = 5.33417 sequence = TACTGTATGGATGTACAGCA Gene: Mpe_B0048: DNA polymerase V, subunit UmuD	Leptothrix cholodnii SP-6	DNA polymerase V, subunit UmuD
umuC	Acidovorax avenae subsp. citrulli AAC00-1	Acidovorax sp. JS42	Comamonas testosteroni KF-1	Delftia acidovorans SPH-1	Polaromonas naphthalenivorans CJ2 Gene: Pnap_4268: DNA polymerase V, subunit UmuC	Polaromonas sp. JS666 Gene: Bpro_4983: DNA polymerase V, subunit UmuC	Rhodoferax ferrireducens DSM 15236 Gene: Rfer_4341: DNA polymerase V, subunit UmuC	Variovorax paradoxus S110	Verminephrobacter eiseniae EF01-2	* Methylibium petroleiphilum PM1 Site: position = -6 score = 5.80485 sequence = TACTGTATGTCCATACAGTA Gene: Mpe_B0052: DNA polymerase V, subunit UmuC	Leptothrix cholodnii SP-6	DNA polymerase V, subunit UmuC

CRON 3.
parE	* Acidovorax avenae subsp. citrulli AAC00-1 Site: position = -52 score = 4.08323 sequence = GGCTGTCTTTCCATCCAGTA Gene: Aave_1340: Topoisomerase IV subunit B (EC 5.99.1.-)	* Acidovorax sp. JS42 Site: position = -35 score = 4.52777 sequence = TCCTGGTTTTATATCCAGCA Gene: Ajs_1014: Topoisomerase IV subunit B (EC 5.99.1.-)	* Comamonas testosteroni KF-1 Site: position = -52 score = 4.38915 sequence = AACTGTGAATTTATCCAGCT Gene: CtesDRAFT_5182: Topoisomerase IV subunit B (EC 5.99.1.-)	Delftia acidovorans SPH-1 Gene: Daci_5085: Topoisomerase IV subunit B (EC 5.99.1.-)	* Polaromonas naphthalenivorans CJ2 Site: position = -64 score = 5.44231 sequence = AACTGTATGTTTGTACAGGT Gene: Pnap_1199: Topoisomerase IV subunit B (EC 5.99.1.-)	* Polaromonas sp. JS666 Site: position = -114 score = 5.29311 sequence = AACTGGGTATTTATCCAGTA Gene: Bpro_3165: Topoisomerase IV subunit B (EC 5.99.1.-)	* Rhodoferax ferrireducens DSM 15236 Site: position = -38 score = 4.15904 sequence = AGCTGTGCTTTCATACAGCC Gene: Rfer_2642: Topoisomerase IV subunit B (EC 5.99.1.-)	Variovorax paradoxus S110 Gene: Vapar_3428: Topoisomerase IV subunit B (EC 5.99.1.-)	* Verminephrobacter eiseniae EF01-2 Site: position = -52 score = 5.0162 sequence = AACTGTTTTTTTATCCAGCT Gene: Veis_1664: Topoisomerase IV subunit B (EC 5.99.1.-)	Methylibium petroleiphilum PM1 Gene: Mpe_A2559: Topoisomerase IV subunit B (EC 5.99.1.-)	Leptothrix cholodnii SP-6 Gene: Lcho_2635: Topoisomerase IV subunit B (EC 5.99.1.-)	Topoisomerase IV subunit B (EC 5.99.1.-)
yjbJ	2 Acidovorax avenae subsp. citrulli AAC00-1 Gene: Aave_0476: Conserved hypothetical protein, similar to lytic transglycosylase Gene: Aave_1341: Conserved hypothetical protein, similar to lytic transglycosylase	Acidovorax sp. JS42 Gene: Ajs_1015: Conserved hypothetical protein, similar to lytic transglycosylase	Comamonas testosteroni KF-1 Gene: CtesDRAFT_5183: Conserved hypothetical protein, similar to lytic transglycosylase	Delftia acidovorans SPH-1 Gene: Daci_5084: Conserved hypothetical protein, similar to lytic transglycosylase	Polaromonas naphthalenivorans CJ2 Gene: Pnap_1200: Conserved hypothetical protein, similar to lytic transglycosylase	Polaromonas sp. JS666 Gene: Bpro_3164: Conserved hypothetical protein, similar to lytic transglycosylase	Rhodoferax ferrireducens DSM 15236	Variovorax paradoxus S110 Gene: Vapar_3427: Conserved hypothetical protein, similar to lytic transglycosylase	Verminephrobacter eiseniae EF01-2	Methylibium petroleiphilum PM1	Leptothrix cholodnii SP-6	Conserved hypothetical protein, similar to lytic transglycosylase
parC	Acidovorax avenae subsp. citrulli AAC00-1 Gene: Aave_1342: Topoisomerase IV subunit A (EC 5.99.1.-)	Acidovorax sp. JS42 Gene: Ajs_1016: Topoisomerase IV subunit A (EC 5.99.1.-)	Comamonas testosteroni KF-1 Gene: CtesDRAFT_5184: Topoisomerase IV subunit A (EC 5.99.1.-)	Delftia acidovorans SPH-1 Gene: Daci_5083: Topoisomerase IV subunit A (EC 5.99.1.-)	Polaromonas naphthalenivorans CJ2 Gene: Pnap_1201: Topoisomerase IV subunit A (EC 5.99.1.-)	Polaromonas sp. JS666 Gene: Bpro_3163: Topoisomerase IV subunit A (EC 5.99.1.-)	Rhodoferax ferrireducens DSM 15236 Gene: Rfer_2641: Topoisomerase IV subunit A (EC 5.99.1.-)	Variovorax paradoxus S110 Gene: Vapar_3425: Topoisomerase IV subunit A (EC 5.99.1.-)	Verminephrobacter eiseniae EF01-2 Gene: Veis_0399: Topoisomerase IV subunit A (EC 5.99.1.-)	Methylibium petroleiphilum PM1 Gene: Mpe_A2558: Topoisomerase IV subunit A (EC 5.99.1.-)	Leptothrix cholodnii SP-6 Gene: Lcho_2632: Topoisomerase IV subunit A (EC 5.99.1.-)	Topoisomerase IV subunit A (EC 5.99.1.-)

CRON 4.
imuA	3 Acidovorax avenae subsp. citrulli AAC00-1* Site: position = -34 score = 5.37367 sequence = TGCTGTATATTTGAACAGTA Gene: Aave_2670: Predicted RecA/RadA recombinase Site: position = -49 score = 5.88406 sequence = TACTGTTTATTCATACAGTG Gene: Aave_0516: Predicted RecA/RadA recombinase Site: position = -43 score = 5.70279 sequence = TACTGTATAAATAATCAGTA Gene: Aave_2734: Predicted RecA/RadA recombinase	* Acidovorax sp. JS42 Site: position = -85 score = 4.94001 sequence = TGCTGGATGAAATCACAGTA Gene: Ajs_1965: Predicted RecA/RadA recombinase	* Comamonas testosteroni KF-1 Site: position = -35 score = 5.6394 sequence = GACTGTATATTTGTACAGTA Gene: CtesDRAFT_1921: Predicted RecA/RadA recombinase	* Delftia acidovorans SPH-1 Site: position = -35 score = 5.84987 sequence = TGCTGTATATTCATACAGTA Gene: Daci_4263: Predicted RecA/RadA recombinase	* Polaromonas naphthalenivorans CJ2 Site: position = -33 score = 6.03388 sequence = TACTGGTTATTCATACAGTA Gene: Pnap_4894: Predicted RecA/RadA recombinase	* Polaromonas sp. JS666 Site: position = -56 score = 6.01672 sequence = TACTGTACATAAATACAGTA Gene: Bpro_2386: Predicted RecA/RadA recombinase	* Rhodoferax ferrireducens DSM 15236 Site: position = -48 score = 5.30853 sequence = TACTGTTGTTTTATACAGTT Gene: Rfer_1225: Predicted RecA/RadA recombinase	2 Variovorax paradoxus S110* Site: position = -32 score = 6.38076 sequence = TACTGTATAAAAATACAGTT Gene: Vapar_3206: Predicted RecA/RadA recombinase Site: position = -32 score = 5.52893 sequence = TACTGTTCATCCATACAGTA Gene: Vapar_4538: Predicted RecA/RadA recombinase	Verminephrobacter eiseniae EF01-2	2 Methylibium petroleiphilum PM1* Site: position = -133 score = 5.2215 sequence = TACTGTATGCCCATACAGTC Gene: Mpe_B0617: Predicted RecA/RadA recombinase Site: position = -44 score = 5.74657 sequence = TACTGTATTTATGTACAGTA Gene: Mpe_A1534: Predicted RecA/RadA recombinase	* Leptothrix cholodnii SP-6 Site: position = -32 score = 5.56293 sequence = GACTGTATGAACATACAGTC Gene: Lcho_2901: Predicted RecA/RadA recombinase	Predicted RecA/RadA recombinase
imuB	3 Acidovorax avenae subsp. citrulli AAC00-1 Gene: Aave_2671: DNA polymerase-like protein PA0670 Gene: Aave_0517: DNA polymerase-like protein PA0670 Gene: Aave_2733: DNA polymerase-like protein PA0670	Acidovorax sp. JS42 Gene: Ajs_1966: DNA polymerase-like protein PA0670	Comamonas testosteroni KF-1 Gene: CtesDRAFT_1920: DNA polymerase-like protein PA0670	Delftia acidovorans SPH-1 Gene: Daci_4262: DNA polymerase-like protein PA0670	Polaromonas naphthalenivorans CJ2 Gene: Pnap_4895: DNA polymerase-like protein PA0670	Polaromonas sp. JS666 Gene: Bpro_2387: DNA polymerase-like protein PA0670	Rhodoferax ferrireducens DSM 15236 Gene: Rfer_1226: DNA polymerase-like protein PA0670	2 Variovorax paradoxus S110 Gene: Vapar_3205: DNA polymerase-like protein PA0670 Gene: Vapar_4537: DNA polymerase-like protein PA0670	Verminephrobacter eiseniae EF01-2	2 Methylibium petroleiphilum PM1 Gene: Mpe_B0618: DNA polymerase-like protein PA0670 Gene: Mpe_A1533: DNA polymerase-like protein PA0670	Leptothrix cholodnii SP-6 Gene: Lcho_2902: DNA polymerase-like protein PA0670	DNA polymerase-like protein PA0670
dnaE2	3 Acidovorax avenae subsp. citrulli AAC00-1 Gene: Aave_2672: DNA polymerase III alpha subunit (EC 2.7.7.7) Gene: Aave_0518: DNA polymerase III alpha subunit (EC 2.7.7.7) Gene: Aave_2732: DNA polymerase III alpha subunit (EC 2.7.7.7)	Acidovorax sp. JS42 Gene: Ajs_1967: DNA polymerase III alpha subunit (EC 2.7.7.7)	Comamonas testosteroni KF-1 Gene: CtesDRAFT_1919: DNA polymerase III alpha subunit (EC 2.7.7.7)	Delftia acidovorans SPH-1 Gene: Daci_4261: DNA polymerase III alpha subunit (EC 2.7.7.7)	Polaromonas naphthalenivorans CJ2 Gene: Pnap_4896: DNA polymerase III alpha subunit (EC 2.7.7.7)	Polaromonas sp. JS666 Gene: Bpro_2388: DNA polymerase III alpha subunit (EC 2.7.7.7)	Rhodoferax ferrireducens DSM 15236 Gene: Rfer_1227: DNA polymerase III alpha subunit (EC 2.7.7.7)	2 Variovorax paradoxus S110 Gene: Vapar_3204: DNA polymerase III alpha subunit (EC 2.7.7.7) Gene: Vapar_4536: DNA polymerase III alpha subunit (EC 2.7.7.7)	Verminephrobacter eiseniae EF01-2	2 Methylibium petroleiphilum PM1 Gene: Mpe_B0619: DNA polymerase III alpha subunit (EC 2.7.7.7) Gene: Mpe_A1532: DNA polymerase III alpha subunit (EC 2.7.7.7)	Leptothrix cholodnii SP-6 Gene: Lcho_2903: DNA polymerase III alpha subunit (EC 2.7.7.7)	DNA polymerase III alpha subunit (EC 2.7.7.7)
Aave_0184	* Acidovorax avenae subsp. citrulli AAC00-1 Site: position = -33 score = 4.75125 sequence = CACTGTATTTACAATCAGTG Gene: Aave_0184: Conserved hypothetical protein	Acidovorax sp. JS42	Comamonas testosteroni KF-1	Delftia acidovorans SPH-1	Polaromonas naphthalenivorans CJ2 Gene: Pnap_1706: Conserved hypothetical protein	Polaromonas sp. JS666 Gene: Bpro_2305: Conserved hypothetical protein	Rhodoferax ferrireducens DSM 15236	Variovorax paradoxus S110 Gene: Vapar_3203: Conserved hypothetical protein	Verminephrobacter eiseniae EF01-2	* Methylibium petroleiphilum PM1 Site: position = -49 score = 5.43999 sequence = TACTGTATTTACGAACAGTA Gene: Mpe_A0910: Conserved hypothetical protein	Leptothrix cholodnii SP-6 Gene: Lcho_0308: Conserved hypothetical protein	Conserved hypothetical protein
PF06733	Acidovorax avenae subsp. citrulli AAC00-1 Gene: Aave_0185: DinG family ATP-dependent helicase CPE1197	Acidovorax sp. JS42 Gene: Ajs_2428: DinG family ATP-dependent helicase CPE1197	Comamonas testosteroni KF-1 Gene: CtesDRAFT_1894: DinG family ATP-dependent helicase CPE1197	Delftia acidovorans SPH-1 Gene: Daci_5813: DinG family ATP-dependent helicase CPE1197	Polaromonas naphthalenivorans CJ2	Polaromonas sp. JS666 Gene: Bpro_1361: DinG family ATP-dependent helicase CPE1197	Rhodoferax ferrireducens DSM 15236	* Variovorax paradoxus S110 Site: position = -26 score = 4.9962 sequence = TACTGTTGTTTTATACAGCA Gene: Vapar_2806: DinG family ATP-dependent helicase CPE1197	Verminephrobacter eiseniae EF01-2	Methylibium petroleiphilum PM1 Gene: Mpe_A0909: DinG family ATP-dependent helicase CPE1197	Leptothrix cholodnii SP-6	DinG family ATP-dependent helicase CPE1197
PF08774	Acidovorax avenae subsp. citrulli AAC00-1	* Acidovorax sp. JS42 Site: position = -75 score = 4.94001 sequence = TGCTGGATGAAATCACAGTA Gene: Ajs_2429: Hypothetical protein, restriction endonuclease-like VRR-NUC domain	* Comamonas testosteroni KF-1 Site: position = -6 score = 5.55904 sequence = AGCTGTATGAAAATACAGGT Gene: CtesDRAFT_1895: Hypothetical protein, restriction endonuclease-like VRR-NUC domain	* Delftia acidovorans SPH-1 Site: position = -54 score = 5.55406 sequence = GACTGTATAAAGATACAGTT Gene: Daci_5814: Hypothetical protein, restriction endonuclease-like VRR-NUC domain	Polaromonas naphthalenivorans CJ2	Polaromonas sp. JS666	Rhodoferax ferrireducens DSM 15236	Variovorax paradoxus S110	Verminephrobacter eiseniae EF01-2	Methylibium petroleiphilum PM1	Leptothrix cholodnii SP-6	Hypothetical protein, restriction endonuclease-like VRR-NUC domain

CRON 5.
recA	* Acidovorax avenae subsp. citrulli AAC00-1 Site: position = -98 score = 4.30784 sequence = TACTGGTCAAGCATCCAGCC Gene: Aave_4640: Recombinase A	* Acidovorax sp. JS42 Site: position = -87 score = 4.34851 sequence = TACTGTTCAAGCATCCAGCC Gene: Ajs_4001: Recombinase A	* Comamonas testosteroni KF-1 Site: position = -76 score = 4.34851 sequence = TACTGTTCAAGCATCCAGCC Gene: CtesDRAFT_3877: Recombinase A	* Delftia acidovorans SPH-1 Site: position = -66 score = 4.34851 sequence = TACTGTTCAAGCATCCAGCC Gene: Daci_0874: Recombinase A	* Polaromonas naphthalenivorans CJ2 Site: position = -102 score = 4.41396 sequence = TACTGTTCATGCACCCAGTA Gene: Pnap_3956: Recombinase A	* Polaromonas sp. JS666 Site: position = -146 score = 4.19855 sequence = AACTGACTAAAAATAGGGTT Gene: Bpro_4685: Recombinase A	* Rhodoferax ferrireducens DSM 15236 Site: position = -38 score = 4.34851 sequence = TACTGTTCAAGCATCCAGCC Gene: Rfer_3948: Recombinase A	* Variovorax paradoxus S110 Site: position = -83 score = 4.34851 sequence = TACTGTTCAAGCATCCAGCC Gene: Vapar_5195: Recombinase A	* Verminephrobacter eiseniae EF01-2 Site: position = -47 score = 4.56632 sequence = TACTGTTCAAGCATCCAGCT Gene: Veis_0355: Recombinase A	* Methylibium petroleiphilum PM1 Site: position = -54 score = 5.28555 sequence = TACTGTACAAATAACCAGTT Gene: Mpe_A0075: Recombinase A	* Leptothrix cholodnii SP-6 Site: position = -56 score = 4.81607 sequence = CACTGTACAAACATCCAGCA Gene: Lcho_0497: Recombinase A	Recombinase A
recX	Acidovorax avenae subsp. citrulli AAC00-1 Gene: Aave_4641: Regulatory protein RecX	Acidovorax sp. JS42 Gene: Ajs_4002: Regulatory protein RecX	Comamonas testosteroni KF-1 Gene: CtesDRAFT_3876: Regulatory protein RecX	Delftia acidovorans SPH-1 Gene: Daci_0873: Regulatory protein RecX	Polaromonas naphthalenivorans CJ2 Gene: Pnap_3955: Regulatory protein RecX	Polaromonas sp. JS666 Gene: Bpro_4684: Regulatory protein RecX	Rhodoferax ferrireducens DSM 15236 Gene: Rfer_3947: Regulatory protein RecX	Variovorax paradoxus S110 Gene: Vapar_5194: Regulatory protein RecX	Verminephrobacter eiseniae EF01-2	Methylibium petroleiphilum PM1 Gene: Mpe_A0074: Regulatory protein RecX	Leptothrix cholodnii SP-6 Gene: Lcho_0496: Regulatory protein RecX	Regulatory protein RecX

CRON 6.
radA	Acidovorax avenae subsp. citrulli AAC00-1 Gene: Aave_0262: DNA repair protein RadA	Acidovorax sp. JS42 Gene: Ajs_0180: DNA repair protein RadA	Comamonas testosteroni KF-1 Gene: CtesDRAFT_3997: DNA repair protein RadA	Delftia acidovorans SPH-1 Gene: Daci_0314: DNA repair protein RadA	Polaromonas naphthalenivorans CJ2 Gene: Pnap_0138: DNA repair protein RadA	* Polaromonas sp. JS666 Site: position = -30 score = 5.66058 sequence = TACTGGTTGTTTGTACAGTA Gene: Bpro_0200: DNA repair protein RadA	2 Rhodoferax ferrireducens DSM 15236* Site: position = -31 score = 4.91177 sequence = ATCTGTTTTTCCATACAGTA Gene: Rfer_0500: DNA repair protein RadA Gene: Rfer_4298: DNA repair protein RadA	Variovorax paradoxus S110 Gene: Vapar_0251: DNA repair protein RadA	Verminephrobacter eiseniae EF01-2 Gene: Veis_0797: DNA repair protein RadA	Methylibium petroleiphilum PM1 Gene: Mpe_A3556: DNA repair protein RadA	Leptothrix cholodnii SP-6 Gene: Lcho_0917: DNA repair protein RadA	DNA repair protein RadA

CRON 7.
lexA	* Acidovorax avenae subsp. citrulli AAC00-1 Site: position = -95 score = 6.0591 sequence = AACTGTTTAAAAATACAGTG Gene: Aave_2558: SOS-response repressor and protease LexA (EC 3.4.21.88)	* Acidovorax sp. JS42 Site: position = -54 score = 5.76961 sequence = TACTGGATTAAAAAACAGTA Site: position = -73 score = 5.50813 sequence = AACTGTTCAAAAATACAGAT Gene: Ajs_2310: SOS-response repressor and protease LexA (EC 3.4.21.88)	* Comamonas testosteroni KF-1 Site: position = -67 score = 5.63136 sequence = AACTGATTAAAAATACAGGT Site: position = -48 score = 5.60636 sequence = TACTGGATGAACACACAGTA Gene: CtesDRAFT_1157: SOS-response repressor and protease LexA (EC 3.4.21.88)	* Delftia acidovorans SPH-1 Site: position = -64 score = 4.72465 sequence = TACTGTATAAATCATCAGAT Site: position = -83 score = 5.82185 sequence = AACTGGTTAAAAATACAGAT Gene: Daci_3565: SOS-response repressor and protease LexA (EC 3.4.21.88)	* Polaromonas naphthalenivorans CJ2 Site: position = -84 score = 5.8947 sequence = TACTGGATATTCATACAGTC Site: position = -103 score = 5.54611 sequence = AGCTGTATAAAAATGCAGTT Gene: Pnap_1918: SOS-response repressor and protease LexA (EC 3.4.21.88)	* Polaromonas sp. JS666 Site: position = -96 score = 5.66533 sequence = TACTGGATATTAAAACAGGT Site: position = -115 score = 6.11857 sequence = AACTGGATGAAAATACAGTT Gene: Bpro_2954: SOS-response repressor and protease LexA (EC 3.4.21.88)	* Rhodoferax ferrireducens DSM 15236 Site: position = -65 score = 4.64268 sequence = TACTGAATACAACAACAGTG Site: position = -84 score = 5.91638 sequence = AACTGATTAAAAATACAGTT Gene: Rfer_2994: SOS-response repressor and protease LexA (EC 3.4.21.88)	* Variovorax paradoxus S110 Site: position = -36 score = 4.94289 sequence = TACTGGATATTCAGCCAGTG Site: position = -55 score = 5.91202 sequence = AACTGGTTAAAAATACAGGT Gene: Vapar_2636: SOS-response repressor and protease LexA (EC 3.4.21.88)	* Verminephrobacter eiseniae EF01-2 Site: position = -56 score = 5.5065 sequence = TACTGGATTGAAAAACAGTT Site: position = -75 score = 5.87282 sequence = AACTGGTTAAAAATACAGCT Gene: Veis_4912: SOS-response repressor and protease LexA (EC 3.4.21.88)	* Methylibium petroleiphilum PM1 Site: position = -67 score = 5.42422 sequence = CACTGGATAAAAATTCAGTG Site: position = -86 score = 5.75456 sequence = AGCTGGATAAAAATACAGTC Gene: Mpe_A1866: SOS-response repressor and protease LexA (EC 3.4.21.88)	* Leptothrix cholodnii SP-6 Site: position = -110 score = 5.37926 sequence = GACTGGATAAAATTACAGTG Gene: Lcho_2082: SOS-response repressor and protease LexA (EC 3.4.21.88)	SOS-response repressor and protease LexA (EC 3.4.21.88)

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulog LexA - Comamonadaceae

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --