Regulon of LexA in Variovorax paradoxus S110

Properties
Regulator type:	Transcription factor
TF locus tag:	Vapar_2636
Regulator family:	LexA
Regulation mode:	repressor
Biological process:	SOS response
Effector:	DNA damage
Regulog:	LexA - Comamonadaceae
Statistics of regulated genes:
- Genes	12
- Operons	6
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 71 sites [see more]

Member of regulog collections

By taxonomy - Comamonadaceae
By trascription factor - LexA
By TF family - LexA
By effector - DNA damage
By pathway - SOS response

Regulated operons
	Locus Tag	Name	Function
Position: -55 Score: 5.9 Sequence: AACTGGTTAAAAATACAGGT Position: -36 Score: 4.9 Sequence: TACTGGATATTCAGCCAGTG Locus tag: Vapar_2636 Name: lexA Funciton: SOS-response repressor and protease LexA (EC 3.4.21.88)
	Vapar_2636	lexA	SOS-response repressor and protease LexA (EC 3.4.21.88)
Position: -26 Score: 5 Sequence: TACTGTTGTTTTATACAGCA Locus tag: Vapar_2806 Name: PF06733 Funciton: DinG family ATP-dependent helicase CPE1197
	Vapar_2806	PF06733	DinG family ATP-dependent helicase CPE1197
Position: -32 Score: 6.4 Sequence: TACTGTATAAAAATACAGTT Locus tag: Vapar_3206 Name: imuA Funciton: Predicted RecA/RadA recombinase Locus tag: Vapar_3205 Name: imuB Funciton: DNA polymerase-like protein PA0670 Locus tag: Vapar_3204 Name: dnaE2 Funciton: DNA polymerase III alpha subunit (EC 2.7.7.7) Locus tag: Vapar_3203 Name: Aave_0184 Funciton: Conserved hypothetical protein
	Vapar_3206	imuA	Predicted RecA/RadA recombinase
	Vapar_3205	imuB	DNA polymerase-like protein PA0670
	Vapar_3204	dnaE2	DNA polymerase III alpha subunit (EC 2.7.7.7)
	Vapar_3203	Aave_0184	Conserved hypothetical protein
Position: -32 Score: 5.5 Sequence: TACTGTTCATCCATACAGTA Locus tag: Vapar_4538 Name: imuA Funciton: Predicted RecA/RadA recombinase Locus tag: Vapar_4537 Name: imuB Funciton: DNA polymerase-like protein PA0670 Locus tag: Vapar_4536 Name: dnaE2 Funciton: DNA polymerase III alpha subunit (EC 2.7.7.7)
	Vapar_4538	imuA	Predicted RecA/RadA recombinase
	Vapar_4537	imuB	DNA polymerase-like protein PA0670
	Vapar_4536	dnaE2	DNA polymerase III alpha subunit (EC 2.7.7.7)
Position: -40 Score: 5.9 Sequence: TACTGTGTAAACATACAGTA Locus tag: Vapar_1693 Name: PF04055 Funciton: DNA repair photolyase
	Vapar_1693	PF04055	DNA repair photolyase
Position: -83 Score: 4.3 Sequence: TACTGTTCAAGCATCCAGCC Locus tag: Vapar_5195 Name: recA Funciton: Recombinase A Locus tag: Vapar_5194 Name: recX Funciton: Regulatory protein RecX
	Vapar_5195	recA	Recombinase A
	Vapar_5194	recX	Regulatory protein RecX

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD