Regulon of LexA in Leptothrix cholodnii SP-6

Properties
Regulator type:	Transcription factor
TF locus tag:	Lcho_2082
Regulator family:	LexA
Regulation mode:	repressor
Biological process:	SOS response
Effector:	DNA damage
Regulog:	LexA - Comamonadaceae
Statistics of regulated genes:
- Genes	7
- Operons	4
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 71 sites [see more]

Member of regulog collections

By taxonomy - Comamonadaceae
By trascription factor - LexA
By TF family - LexA
By effector - DNA damage
By pathway - SOS response

Regulated operons
	Locus Tag	Name	Function
Position: -110 Score: 5.4 Sequence: GACTGGATAAAATTACAGTG Locus tag: Lcho_2082 Name: lexA Funciton: SOS-response repressor and protease LexA (EC 3.4.21.88)
	Lcho_2082	lexA	SOS-response repressor and protease LexA (EC 3.4.21.88)
Position: -56 Score: 4.8 Sequence: CACTGTACAAACATCCAGCA Locus tag: Lcho_0497 Name: recA Funciton: Recombinase A Locus tag: Lcho_0496 Name: recX Funciton: Regulatory protein RecX
	Lcho_0497	recA	Recombinase A
	Lcho_0496	recX	Regulatory protein RecX
Position: -39 Score: 5.1 Sequence: AACTGTATGCGCATACAGTT Locus tag: Lcho_2079 Name: PF04055 Funciton: DNA repair photolyase
	Lcho_2079	PF04055	DNA repair photolyase
Position: -32 Score: 5.6 Sequence: GACTGTATGAACATACAGTC Locus tag: Lcho_2901 Name: imuA Funciton: Predicted RecA/RadA recombinase Locus tag: Lcho_2902 Name: imuB Funciton: DNA polymerase-like protein PA0670 Locus tag: Lcho_2903 Name: null Funciton: DNA polymerase III alpha subunit (EC 2.7.7.7)
	Lcho_2901	imuA	Predicted RecA/RadA recombinase
	Lcho_2902	imuB	DNA polymerase-like protein PA0670
	Lcho_2903		DNA polymerase III alpha subunit (EC 2.7.7.7)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD