Regulon of LexA in Comamonas testosteroni KF-1

Properties
Regulator type:	Transcription factor
TF locus tag:	CtesDRAFT_1157
Regulator family:	LexA
Regulation mode:	repressor
Biological process:	SOS response
Effector:	DNA damage
Regulog:	LexA - Comamonadaceae
Statistics of regulated genes:
- Genes	11
- Operons	5
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 71 sites [see more]

Member of regulog collections

By taxonomy - Comamonadaceae
By trascription factor - LexA
By TF family - LexA
By effector - DNA damage
By pathway - SOS response

Regulated operons
	Locus Tag	Name	Function
Position: -67 Score: 5.6 Sequence: AACTGATTAAAAATACAGGT Position: -48 Score: 5.6 Sequence: TACTGGATGAACACACAGTA Locus tag: CtesDRAFT_1157 Name: lexA Funciton: SOS-response repressor and protease LexA (EC 3.4.21.88)
	CtesDRAFT_1157	lexA	SOS-response repressor and protease LexA (EC 3.4.21.88)
Position: -6 Score: 5.6 Sequence: AGCTGTATGAAAATACAGGT Locus tag: CtesDRAFT_1895 Name: PF08774 Funciton: Hypothetical protein, restriction endonuclease-like VRR-NUC domain Locus tag: CtesDRAFT_1894 Name: PF06733 Funciton: DinG family ATP-dependent helicase CPE1197
	CtesDRAFT_1895	PF08774	Hypothetical protein, restriction endonuclease-like VRR-NUC domain
	CtesDRAFT_1894	PF06733	DinG family ATP-dependent helicase CPE1197
Position: -35 Score: 5.6 Sequence: GACTGTATATTTGTACAGTA Locus tag: CtesDRAFT_1921 Name: imuA Funciton: Predicted RecA/RadA recombinase Locus tag: CtesDRAFT_1920 Name: imuB Funciton: DNA polymerase-like protein PA0670 Locus tag: CtesDRAFT_1919 Name: dnaE2 Funciton: DNA polymerase III alpha subunit (EC 2.7.7.7)
	CtesDRAFT_1921	imuA	Predicted RecA/RadA recombinase
	CtesDRAFT_1920	imuB	DNA polymerase-like protein PA0670
	CtesDRAFT_1919	dnaE2	DNA polymerase III alpha subunit (EC 2.7.7.7)
Position: -52 Score: 4.4 Sequence: AACTGTGAATTTATCCAGCT Locus tag: CtesDRAFT_5182 Name: parE Funciton: Topoisomerase IV subunit B (EC 5.99.1.-) Locus tag: CtesDRAFT_5183 Name: yjbJ Funciton: Conserved hypothetical protein, similar to lytic transglycosylase Locus tag: CtesDRAFT_5184 Name: parC Funciton: Topoisomerase IV subunit A (EC 5.99.1.-)
	CtesDRAFT_5182	parE	Topoisomerase IV subunit B (EC 5.99.1.-)
	CtesDRAFT_5183	yjbJ	Conserved hypothetical protein, similar to lytic transglycosylase
	CtesDRAFT_5184	parC	Topoisomerase IV subunit A (EC 5.99.1.-)
Position: -76 Score: 4.3 Sequence: TACTGTTCAAGCATCCAGCC Locus tag: CtesDRAFT_3877 Name: recA Funciton: Recombinase A Locus tag: CtesDRAFT_3876 Name: recX Funciton: Regulatory protein RecX
	CtesDRAFT_3877	recA	Recombinase A
	CtesDRAFT_3876	recX	Regulatory protein RecX

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD