Regulon of LexA in Methylibium petroleiphilum PM1

Properties
Regulator type:	Transcription factor
TF locus tag:	Mpe_A1866
Regulator family:	LexA
Regulation mode:	repressor
Biological process:	SOS response
Effector:	DNA damage
Regulog:	LexA - Comamonadaceae
Statistics of regulated genes:
- Genes	14
- Operons	8
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 71 sites [see more]

Member of regulog collections

By taxonomy - Comamonadaceae
By trascription factor - LexA
By TF family - LexA
By effector - DNA damage
By pathway - SOS response

Regulated operons
	Locus Tag	Name	Function
Position: -49 Score: 5.4 Sequence: TACTGTATTTACGAACAGTA Locus tag: Mpe_A0910 Name: Aave_0184 Funciton: Conserved hypothetical protein Locus tag: Mpe_A0909 Name: null Funciton: DinG family ATP-dependent helicase CPE1197
	Mpe_A0910	Aave_0184	Conserved hypothetical protein
	Mpe_A0909		DinG family ATP-dependent helicase CPE1197
Position: -86 Score: 5.8 Sequence: AGCTGGATAAAAATACAGTC Position: -67 Score: 5.4 Sequence: CACTGGATAAAAATTCAGTG Locus tag: Mpe_A1866 Name: lexA Funciton: SOS-response repressor and protease LexA (EC 3.4.21.88)
	Mpe_A1866	lexA	SOS-response repressor and protease LexA (EC 3.4.21.88)
Position: -54 Score: 5.3 Sequence: TACTGTACAAATAACCAGTT Locus tag: Mpe_A0075 Name: recA Funciton: Recombinase A Locus tag: Mpe_A0074 Name: recX Funciton: Regulatory protein RecX
	Mpe_A0075	recA	Recombinase A
	Mpe_A0074	recX	Regulatory protein RecX
Position: -133 Score: 5.2 Sequence: TACTGTATGCCCATACAGTC Locus tag: Mpe_B0617 Name: imuA Funciton: Predicted RecA/RadA recombinase Locus tag: Mpe_B0618 Name: imuB Funciton: DNA polymerase-like protein PA0670 Locus tag: Mpe_B0619 Name: dnaE2 Funciton: DNA polymerase III alpha subunit (EC 2.7.7.7)
	Mpe_B0617	imuA	Predicted RecA/RadA recombinase
	Mpe_B0618	imuB	DNA polymerase-like protein PA0670
	Mpe_B0619	dnaE2	DNA polymerase III alpha subunit (EC 2.7.7.7)
Position: -6 Score: 5.8 Sequence: TACTGTATGTCCATACAGTA Locus tag: Mpe_B0052 Name: umuC Funciton: DNA polymerase V, subunit UmuC
	Mpe_B0052	umuC	DNA polymerase V, subunit UmuC
Position: -55 Score: 5.3 Sequence: TACTGTATGGATGTACAGCA Locus tag: Mpe_B0048 Name: umuD Funciton: DNA polymerase V, subunit UmuD
	Mpe_B0048	umuD	DNA polymerase V, subunit UmuD
Position: -33 Score: 6 Sequence: TACTGTACAAAAATACAGTA Locus tag: Mpe_A2509 Name: PF04055 Funciton: DNA repair photolyase
	Mpe_A2509	PF04055	DNA repair photolyase
Position: -44 Score: 5.7 Sequence: TACTGTATTTATGTACAGTA Locus tag: Mpe_A1534 Name: imuA Funciton: Predicted RecA/RadA recombinase Locus tag: Mpe_A1533 Name: imuB Funciton: DNA polymerase-like protein PA0670 Locus tag: Mpe_A1532 Name: null Funciton: DNA polymerase III alpha subunit (EC 2.7.7.7)
	Mpe_A1534	imuA	Predicted RecA/RadA recombinase
	Mpe_A1533	imuB	DNA polymerase-like protein PA0670
	Mpe_A1532		DNA polymerase III alpha subunit (EC 2.7.7.7)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulon of LexA in Methylibium petroleiphilum PM1

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --