Regulon of LexA in Acidovorax sp. JS42

Properties
Regulator type:	Transcription factor
TF locus tag:	Ajs_2310
Regulator family:	LexA
Regulation mode:	repressor
Biological process:	SOS response
Effector:	DNA damage
Regulog:	LexA - Comamonadaceae
Statistics of regulated genes:
- Genes	12
- Operons	6
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 71 sites [see more]

Member of regulog collections

By taxonomy - Comamonadaceae
By trascription factor - LexA
By TF family - LexA
By effector - DNA damage
By pathway - SOS response

Regulated operons
	Locus Tag	Name	Function
Position: -73 Score: 5.5 Sequence: AACTGTTCAAAAATACAGAT Position: -54 Score: 5.8 Sequence: TACTGGATTAAAAAACAGTA Locus tag: Ajs_2310 Name: lexA Funciton: SOS-response repressor and protease LexA (EC 3.4.21.88)
	Ajs_2310	lexA	SOS-response repressor and protease LexA (EC 3.4.21.88)
Position: -85 Score: 4.9 Sequence: TGCTGGATGAAATCACAGTA Locus tag: Ajs_1965 Name: imuA Funciton: Predicted RecA/RadA recombinase Locus tag: Ajs_1966 Name: imuB Funciton: DNA polymerase-like protein PA0670 Locus tag: Ajs_1967 Name: dnaE2 Funciton: DNA polymerase III alpha subunit (EC 2.7.7.7)
	Ajs_1965	imuA	Predicted RecA/RadA recombinase
	Ajs_1966	imuB	DNA polymerase-like protein PA0670
	Ajs_1967	dnaE2	DNA polymerase III alpha subunit (EC 2.7.7.7)
Position: -75 Score: 4.9 Sequence: TGCTGGATGAAATCACAGTA Locus tag: Ajs_2429 Name: PF08774 Funciton: Hypothetical protein, restriction endonuclease-like VRR-NUC domain Locus tag: Ajs_2428 Name: PF06733 Funciton: DinG family ATP-dependent helicase CPE1197
	Ajs_2429	PF08774	Hypothetical protein, restriction endonuclease-like VRR-NUC domain
	Ajs_2428	PF06733	DinG family ATP-dependent helicase CPE1197
Position: -35 Score: 4.5 Sequence: TCCTGGTTTTATATCCAGCA Locus tag: Ajs_1014 Name: parE Funciton: Topoisomerase IV subunit B (EC 5.99.1.-) Locus tag: Ajs_1015 Name: yjbJ Funciton: Conserved hypothetical protein, similar to lytic transglycosylase Locus tag: Ajs_1016 Name: parC Funciton: Topoisomerase IV subunit A (EC 5.99.1.-)
	Ajs_1014	parE	Topoisomerase IV subunit B (EC 5.99.1.-)
	Ajs_1015	yjbJ	Conserved hypothetical protein, similar to lytic transglycosylase
	Ajs_1016	parC	Topoisomerase IV subunit A (EC 5.99.1.-)
Position: -23 Score: 4.9 Sequence: TGCTGGATGAAATCACAGTA Locus tag: Ajs_2803 Name: PF04055 Funciton: DNA repair photolyase
	Ajs_2803	PF04055	DNA repair photolyase
Position: -87 Score: 4.3 Sequence: TACTGTTCAAGCATCCAGCC Locus tag: Ajs_4001 Name: recA Funciton: Recombinase A Locus tag: Ajs_4002 Name: recX Funciton: Regulatory protein RecX
	Ajs_4001	recA	Recombinase A
	Ajs_4002	recX	Regulatory protein RecX

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD