Regulon of LexA in Polaromonas naphthalenivorans CJ2

Properties
Regulator type:	Transcription factor
TF locus tag:	Pnap_1918
Regulator family:	LexA
Regulation mode:	repressor
Biological process:	SOS response
Effector:	DNA damage
Regulog:	LexA - Comamonadaceae
Statistics of regulated genes:
- Genes	9
- Operons	4
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 71 sites [see more]

Member of regulog collections

By taxonomy - Comamonadaceae
By trascription factor - LexA
By TF family - LexA
By effector - DNA damage
By pathway - SOS response

Regulated operons
	Locus Tag	Name	Function
Position: -103 Score: 5.5 Sequence: AGCTGTATAAAAATGCAGTT Position: -84 Score: 5.9 Sequence: TACTGGATATTCATACAGTC Locus tag: Pnap_1918 Name: lexA Funciton: SOS-response repressor and protease LexA (EC 3.4.21.88)
	Pnap_1918	lexA	SOS-response repressor and protease LexA (EC 3.4.21.88)
Position: -64 Score: 5.4 Sequence: AACTGTATGTTTGTACAGGT Locus tag: Pnap_1199 Name: parE Funciton: Topoisomerase IV subunit B (EC 5.99.1.-) Locus tag: Pnap_1200 Name: yjbJ Funciton: Conserved hypothetical protein, similar to lytic transglycosylase Locus tag: Pnap_1201 Name: parC Funciton: Topoisomerase IV subunit A (EC 5.99.1.-)
	Pnap_1199	parE	Topoisomerase IV subunit B (EC 5.99.1.-)
	Pnap_1200	yjbJ	Conserved hypothetical protein, similar to lytic transglycosylase
	Pnap_1201	parC	Topoisomerase IV subunit A (EC 5.99.1.-)
Position: -33 Score: 6 Sequence: TACTGGTTATTCATACAGTA Locus tag: Pnap_4894 Name: imuA Funciton: Predicted RecA/RadA recombinase Locus tag: Pnap_4895 Name: imuB Funciton: DNA polymerase-like protein PA0670 Locus tag: Pnap_4896 Name: dnaE2 Funciton: DNA polymerase III alpha subunit (EC 2.7.7.7)
	Pnap_4894	imuA	Predicted RecA/RadA recombinase
	Pnap_4895	imuB	DNA polymerase-like protein PA0670
	Pnap_4896	dnaE2	DNA polymerase III alpha subunit (EC 2.7.7.7)
Position: -102 Score: 4.4 Sequence: TACTGTTCATGCACCCAGTA Locus tag: Pnap_3956 Name: recA Funciton: Recombinase A Locus tag: Pnap_3955 Name: recX Funciton: Regulatory protein RecX
	Pnap_3956	recA	Recombinase A
	Pnap_3955	recX	Regulatory protein RecX

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD