Regulon of LexA in Rhodoferax ferrireducens DSM 15236

Properties
Regulator type:	Transcription factor
TF locus tag:	Rfer_2994
Regulator family:	LexA
Regulation mode:	repressor
Biological process:	SOS response
Effector:	DNA damage
Regulog:	LexA - Comamonadaceae
Statistics of regulated genes:
- Genes	11
- Operons	6
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 71 sites [see more]

Member of regulog collections

By taxonomy - Comamonadaceae
By trascription factor - LexA
By TF family - LexA
By effector - DNA damage
By pathway - SOS response

Regulated operons
	Locus Tag	Name	Function
Position: -84 Score: 5.9 Sequence: AACTGATTAAAAATACAGTT Position: -65 Score: 4.6 Sequence: TACTGAATACAACAACAGTG Locus tag: Rfer_2994 Name: lexA Funciton: SOS-response repressor and protease LexA (EC 3.4.21.88)
	Rfer_2994	lexA	SOS-response repressor and protease LexA (EC 3.4.21.88)
Position: -48 Score: 5.3 Sequence: TACTGTTGTTTTATACAGTT Locus tag: Rfer_1225 Name: imuA Funciton: Predicted RecA/RadA recombinase Locus tag: Rfer_1226 Name: imuB Funciton: DNA polymerase-like protein PA0670 Locus tag: Rfer_1227 Name: dnaE2 Funciton: DNA polymerase III alpha subunit (EC 2.7.7.7)
	Rfer_1225	imuA	Predicted RecA/RadA recombinase
	Rfer_1226	imuB	DNA polymerase-like protein PA0670
	Rfer_1227	dnaE2	DNA polymerase III alpha subunit (EC 2.7.7.7)
Position: -38 Score: 4.2 Sequence: AGCTGTGCTTTCATACAGCC Locus tag: Rfer_2642 Name: parE Funciton: Topoisomerase IV subunit B (EC 5.99.1.-) Locus tag: Rfer_2641 Name: parC Funciton: Topoisomerase IV subunit A (EC 5.99.1.-)
	Rfer_2642	parE	Topoisomerase IV subunit B (EC 5.99.1.-)
	Rfer_2641	parC	Topoisomerase IV subunit A (EC 5.99.1.-)
Position: -10 Score: 5 Sequence: TACTGTATGGATGATCAGTA Locus tag: Rfer_4342 Name: umuD Funciton: DNA polymerase V, subunit UmuD Locus tag: Rfer_4341 Name: umuC Funciton: DNA polymerase V, subunit UmuC
	Rfer_4342	umuD	DNA polymerase V, subunit UmuD
	Rfer_4341	umuC	DNA polymerase V, subunit UmuC
Position: -38 Score: 4.3 Sequence: TACTGTTCAAGCATCCAGCC Locus tag: Rfer_3948 Name: recA Funciton: Recombinase A Locus tag: Rfer_3947 Name: recX Funciton: Regulatory protein RecX
	Rfer_3948	recA	Recombinase A
	Rfer_3947	recX	Regulatory protein RecX
Position: -31 Score: 4.9 Sequence: ATCTGTTTTTCCATACAGTA Locus tag: Rfer_0500 Name: radA Funciton: DNA repair protein RadA
	Rfer_0500	radA	DNA repair protein RadA

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD