Regulon of LexA in Verminephrobacter eiseniae EF01-2

Properties
Regulator type:	Transcription factor
TF locus tag:	Veis_4912
Regulator family:	LexA
Regulation mode:	repressor
Biological process:	SOS response
Effector:	DNA damage
Regulog:	LexA - Comamonadaceae
Statistics of regulated genes:
- Genes	3
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 71 sites [see more]

Member of regulog collections

By taxonomy - Comamonadaceae
By trascription factor - LexA
By TF family - LexA
By effector - DNA damage
By pathway - SOS response

Regulated operons
	Locus Tag	Name	Function
Position: -75 Score: 5.9 Sequence: AACTGGTTAAAAATACAGCT Position: -56 Score: 5.5 Sequence: TACTGGATTGAAAAACAGTT Locus tag: Veis_4912 Name: lexA Funciton: SOS-response repressor and protease LexA (EC 3.4.21.88)
	Veis_4912	lexA	SOS-response repressor and protease LexA (EC 3.4.21.88)
Position: -47 Score: 4.6 Sequence: TACTGTTCAAGCATCCAGCT Locus tag: Veis_0355 Name: recA Funciton: Recombinase A
	Veis_0355	recA	Recombinase A
Position: -52 Score: 5 Sequence: AACTGTTTTTTTATCCAGCT Locus tag: Veis_1664 Name: parE Funciton: Topoisomerase IV subunit B (EC 5.99.1.-)
	Veis_1664	parE	Topoisomerase IV subunit B (EC 5.99.1.-)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD