Regulon of LexA in Delftia acidovorans SPH-1

Properties
Regulator type:	Transcription factor
TF locus tag:	Daci_3565
Regulator family:	LexA
Regulation mode:	repressor
Biological process:	SOS response
Effector:	DNA damage
Regulog:	LexA - Comamonadaceae
Statistics of regulated genes:
- Genes	9
- Operons	5
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 71 sites [see more]

Member of regulog collections

By taxonomy - Comamonadaceae
By trascription factor - LexA
By TF family - LexA
By effector - DNA damage
By pathway - SOS response

Regulated operons
	Locus Tag	Name	Function
Position: -83 Score: 5.8 Sequence: AACTGGTTAAAAATACAGAT Position: -64 Score: 4.7 Sequence: TACTGTATAAATCATCAGAT Locus tag: Daci_3565 Name: lexA Funciton: SOS-response repressor and protease LexA (EC 3.4.21.88)
	Daci_3565	lexA	SOS-response repressor and protease LexA (EC 3.4.21.88)
Position: -35 Score: 5.8 Sequence: TGCTGTATATTCATACAGTA Locus tag: Daci_4263 Name: imuA Funciton: Predicted RecA/RadA recombinase Locus tag: Daci_4262 Name: imuB Funciton: DNA polymerase-like protein PA0670 Locus tag: Daci_4261 Name: dnaE2 Funciton: DNA polymerase III alpha subunit (EC 2.7.7.7)
	Daci_4263	imuA	Predicted RecA/RadA recombinase
	Daci_4262	imuB	DNA polymerase-like protein PA0670
	Daci_4261	dnaE2	DNA polymerase III alpha subunit (EC 2.7.7.7)
Position: -54 Score: 5.6 Sequence: GACTGTATAAAGATACAGTT Locus tag: Daci_5814 Name: PF08774 Funciton: Hypothetical protein, restriction endonuclease-like VRR-NUC domain Locus tag: Daci_5813 Name: PF06733 Funciton: DinG family ATP-dependent helicase CPE1197
	Daci_5814	PF08774	Hypothetical protein, restriction endonuclease-like VRR-NUC domain
	Daci_5813	PF06733	DinG family ATP-dependent helicase CPE1197
Position: 2 Score: 5.6 Sequence: GACTGTATTTTTATACAGTT Locus tag: Daci_2403 Name: PF04055 Funciton: DNA repair photolyase
	Daci_2403	PF04055	DNA repair photolyase
Position: -66 Score: 4.3 Sequence: TACTGTTCAAGCATCCAGCC Locus tag: Daci_0874 Name: recA Funciton: Recombinase A Locus tag: Daci_0873 Name: recX Funciton: Regulatory protein RecX
	Daci_0874	recA	Recombinase A
	Daci_0873	recX	Regulatory protein RecX

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD