Regulog LexA - Oceanospirillales/Alteromonadales

Properties
Regulator type:	Transcription factor
Regulator family:	LexA
Regulation mode:	repressor
Biological process:	SOS response
Effector:	DNA damage
Phylum:	Proteobacteria/gamma
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 91 sites [see more]

Member of regulog collections

By taxonomy - Oceanospirillales/Alteromonadales
By trascription factor - LexA
By TF family - LexA
By effector - DNA damage
By pathway - SOS response

Statistics of regulated genes
Genome	Genes	Operons
Hahella chejuensis KCTC 2396	9	7
Marinobacter aqueolei	12	9
Marinobacter sp. ELB17	10	7
Oceanobacter sp. RED65	10	7
Oceanospirillum sp. MED92	14	8
Marinomonas sp. MWYL1	14	11
Saccharophagus degradans 2-40	11	8
Teredinibacter turnerae T7901	10	8
Cellvibrio japonicus Ueda107	6	4
Chromohalobacter salexigens DSM 3043	6	4
Reinekea sp. MED297	12	9
Alcanivorax borkumensis SK2	9	6

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes													Function

CRON 1.
dnaQ	Hahella chejuensis KCTC 2396	Marinobacter aqueolei	Marinobacter sp. ELB17	* Oceanobacter sp. RED65 Site: position = -41 score = 6.04088 sequence = TACTGTATATAAATACAGCT Site: position = -54 score = 5.12312 sequence = CACTTTATAAATATACTGTA Gene: RED65_02924: DNA polymerase III epsilon subunit (EC 2.7.7.7)	Oceanospirillum sp. MED92	Marinomonas sp. MWYL1	Saccharophagus degradans 2-40	Teredinibacter turnerae T7901	Cellvibrio japonicus Ueda107	Chromohalobacter salexigens DSM 3043	Reinekea sp. MED297	Alcanivorax borkumensis SK2	DNA polymerase III epsilon subunit (EC 2.7.7.7)

CRON 2.
recA	* Hahella chejuensis KCTC 2396 Site: position = -76 score = 5.18281 sequence = TGCTGTCAATTTATACAGTA Gene: HCH_05232: Recombinase A	* Marinobacter aqueolei Site: position = -108 score = 5.74382 sequence = TACTGTTCAAATATACAGGA Gene: Maqu_2082: Recombinase A	* Marinobacter sp. ELB17 Site: position = -142 score = 5.25952 sequence = TGCTGGTTAAATATACAGTG Gene: MELB17_08004: Recombinase A	* Oceanobacter sp. RED65 Site: position = -102 score = 5.32111 sequence = TACTGGTTAAATTTACAGTG Gene: RED65_07869: Recombinase A	* Oceanospirillum sp. MED92 Site: position = -61 score = 5.70033 sequence = TACTGTCCATACATACAGTA Gene: MED92_08116: Recombinase A	* Marinomonas sp. MWYL1 Site: position = -87 score = 5.95242 sequence = TACTGTTTTTATATACAGTA Gene: Mmwyl1_3732: Recombinase A	* Saccharophagus degradans 2-40 Site: position = -163 score = 5.17812 sequence = TACTGTATAAAAAACTATTA Gene: Sde_1288: Recombinase A	* Teredinibacter turnerae T7901 Site: position = -242 score = 5.3243 sequence = CACTGTTTACACGTACAGTA Gene: TERTU_2823: Recombinase A	* Cellvibrio japonicus Ueda107 Site: position = -126 score = 5.1653 sequence = CACTGTATAAATTACTAGTA Gene: CJA_2230: Recombinase A	* Chromohalobacter salexigens DSM 3043 Site: position = -90 score = 4.95888 sequence = TACTGGCTAGTCATACAGTA Gene: Csal_0623: Recombinase A	* Reinekea sp. MED297 Site: position = -31 score = 4.98751 sequence = TACTGGTCATTCATACAGCA Gene: MED297_13572: Recombinase A	* Alcanivorax borkumensis SK2 Site: position = -109 score = 4.34463 sequence = TACTGTCCATAACGCCAGTG Gene: ABO_1801: Recombinase A	Recombinase A
recX	Hahella chejuensis KCTC 2396 Gene: HCH_02189: Regulatory protein RecX	Marinobacter aqueolei Gene: Maqu_2486: Regulatory protein RecX	Marinobacter sp. ELB17 Gene: MELB17_16123: Regulatory protein RecX	Oceanobacter sp. RED65 Gene: RED65_07864: Regulatory protein RecX	Oceanospirillum sp. MED92 Gene: MED92_08121: Regulatory protein RecX	Marinomonas sp. MWYL1 Gene: Mmwyl1_3631: Regulatory protein RecX	Saccharophagus degradans 2-40 Gene: Sde_1289: Regulatory protein RecX	Teredinibacter turnerae T7901 Gene: TERTU_2821: Regulatory protein RecX	Cellvibrio japonicus Ueda107 Gene: CJA_2228: Regulatory protein RecX	Chromohalobacter salexigens DSM 3043 Gene: Csal_0624: Regulatory protein RecX	Reinekea sp. MED297 Gene: MED297_13577: Regulatory protein RecX	Alcanivorax borkumensis SK2 Gene: ABO_1800: Regulatory protein RecX	Regulatory protein RecX

CRON 3.
imuA	* Hahella chejuensis KCTC 2396 Site: position = -62 score = 5.45802 sequence = TACTGATTTTATATACAGTA Gene: HCH_02202: Predicted RecA/RadA recombinase	* Marinobacter aqueolei Site: position = -34 score = 6.53147 sequence = TACTGTATATATAAACAGTA Gene: Maqu_0975: Predicted RecA/RadA recombinase	* Marinobacter sp. ELB17 Site: position = -35 score = 6.53147 sequence = TACTGTATATATAAACAGTA Gene: MELB17_15581: Predicted RecA/RadA recombinase	* Oceanobacter sp. RED65 Site: position = -38 score = 6.58301 sequence = TACTGTATATATATACAGTA Gene: RED65_01690: Predicted RecA/RadA recombinase	Oceanospirillum sp. MED92	Marinomonas sp. MWYL1	* Saccharophagus degradans 2-40 Site: position = -38 score = 5.69906 sequence = TACTGTATAGACATACAGCA Gene: Sde_1030: Predicted RecA/RadA recombinase	* Teredinibacter turnerae T7901 Site: position = -37 score = 6.16717 sequence = TACTGTATATTAATACAGTT Gene: TERTU_2925: Predicted RecA/RadA recombinase	Cellvibrio japonicus Ueda107	Chromohalobacter salexigens DSM 3043	* Reinekea sp. MED297 Site: position = -35 score = 6.33719 sequence = TACTGTATATACATACAGTT Gene: MED297_04849: Predicted RecA/RadA recombinase	Alcanivorax borkumensis SK2	Predicted RecA/RadA recombinase
imuB	Hahella chejuensis KCTC 2396 Gene: HCH_02201: DNA polymerase-like protein PA0670	Marinobacter aqueolei Gene: Maqu_0974: DNA polymerase-like protein PA0670	Marinobacter sp. ELB17 Gene: MELB17_15586: DNA polymerase-like protein PA0670	Oceanobacter sp. RED65 Gene: RED65_01685: DNA polymerase-like protein PA0670	Oceanospirillum sp. MED92	Marinomonas sp. MWYL1	Saccharophagus degradans 2-40 Gene: Sde_1029: DNA polymerase-like protein PA0670	Teredinibacter turnerae T7901 Gene: TERTU_2926: DNA polymerase-like protein PA0670	Cellvibrio japonicus Ueda107	Chromohalobacter salexigens DSM 3043	Reinekea sp. MED297 Gene: MED297_04854: DNA polymerase-like protein PA0670	Alcanivorax borkumensis SK2	DNA polymerase-like protein PA0670
dnaE2	Hahella chejuensis KCTC 2396 Gene: HCH_02200: DNA polymerase III alpha subunit (EC 2.7.7.7)	Marinobacter aqueolei Gene: Maqu_0973: DNA polymerase III alpha subunit (EC 2.7.7.7)	Marinobacter sp. ELB17 Gene: MELB17_15591: DNA polymerase III alpha subunit (EC 2.7.7.7)	Oceanobacter sp. RED65 Gene: RED65_01680: DNA polymerase III alpha subunit (EC 2.7.7.7)	Oceanospirillum sp. MED92	Marinomonas sp. MWYL1	Saccharophagus degradans 2-40 Gene: Sde_1028: DNA polymerase III alpha subunit (EC 2.7.7.7)	* Teredinibacter turnerae T7901 Site: position = -30 score = 5.852 sequence = AACTGTATATTTAAACAGCA Gene: TERTU_2929: DNA polymerase III alpha subunit (EC 2.7.7.7)	Cellvibrio japonicus Ueda107	Chromohalobacter salexigens DSM 3043	Reinekea sp. MED297 Gene: MED297_04859: DNA polymerase III alpha subunit (EC 2.7.7.7)	Alcanivorax borkumensis SK2	DNA polymerase III alpha subunit (EC 2.7.7.7)

CRON 4.
Sde_0008	Hahella chejuensis KCTC 2396	Marinobacter aqueolei	Marinobacter sp. ELB17	Oceanobacter sp. RED65	Oceanospirillum sp. MED92	Marinomonas sp. MWYL1	Saccharophagus degradans 2-40 Gene: Sde_0008: Conserved hypothetical protein	Teredinibacter turnerae T7901	Cellvibrio japonicus Ueda107 Gene: CJA_2697: Conserved hypothetical protein	Chromohalobacter salexigens DSM 3043	Reinekea sp. MED297	* Alcanivorax borkumensis SK2 Site: position = -40 score = 4.29608 sequence = CACTGACCATAAGAACAGTC Gene: ABO_0311: Conserved hypothetical protein	Conserved hypothetical protein
recN	* Hahella chejuensis KCTC 2396 Site: position = -41 score = 5.84176 sequence = AACTGTATATATAGACAGTC Gene: HCH_01222: DNA repair protein RecN	* Marinobacter aqueolei Site: position = -62 score = 5.81245 sequence = CACTGTATGAAAAAACAGTA Gene: Maqu_3364: DNA repair protein RecN	* Marinobacter sp. ELB17 Site: position = -46 score = 5.81245 sequence = CACTGTATGAAAAAACAGTA Gene: MELB17_03505: DNA repair protein RecN	* Oceanobacter sp. RED65 Site: position = -70 score = 5.86093 sequence = TACTGTATAAATAAACATAT Gene: RED65_13487: DNA repair protein RecN	* Oceanospirillum sp. MED92 Site: position = -28 score = 5.26215 sequence = CACTGTATAAAAACACATGT Gene: MED92_07346: DNA repair protein RecN	* Marinomonas sp. MWYL1 Site: position = -50 score = 5.56975 sequence = TACTGTATAAATAACCATAT Gene: Mmwyl1_3966: DNA repair protein RecN	* Saccharophagus degradans 2-40 Site: position = -43 score = 5.22627 sequence = CACTGTATAAATAACCATAC Gene: Sde_2735: DNA repair protein RecN	* Teredinibacter turnerae T7901 Site: position = -65 score = 5.5637 sequence = TACTGTATAAATAGCCAATA Gene: TERTU_3298: DNA repair protein RecN	* Cellvibrio japonicus Ueda107 Site: position = -49 score = 5.82528 sequence = TACTGTATAAACAGACAGAT Gene: CJA_3351: DNA repair protein RecN	* Chromohalobacter salexigens DSM 3043 Site: position = -52 score = 5.70109 sequence = TACTGTATAAACACACAGAG Gene: Csal_3096: DNA repair protein RecN	* Reinekea sp. MED297 Site: position = -82 score = 5.76114 sequence = AACTGTATATATATACATAT Gene: MED297_09676: DNA repair protein RecN	Alcanivorax borkumensis SK2 Gene: ABO_0310: DNA repair protein RecN	DNA repair protein RecN

CRON 5.
lexA	* Hahella chejuensis KCTC 2396 Site: position = -82 score = 5.82207 sequence = TACTGTATACATAAACAGAC Gene: HCH_02068: SOS-response repressor and protease LexA (EC 3.4.21.88)	* Marinobacter aqueolei Site: position = -42 score = 5.90997 sequence = CACTGTATAAAAAAACAGGA Gene: Maqu_2007: SOS-response repressor and protease LexA (EC 3.4.21.88)	* Marinobacter sp. ELB17 Site: position = -47 score = 5.634 sequence = CACTGTATAAACAAACAGGG Gene: MELB17_18189: SOS-response repressor and protease LexA (EC 3.4.21.88)	* Oceanobacter sp. RED65 Site: position = -65 score = 5.22393 sequence = TACTTTACATACATACAGCA Site: position = -30 score = 5.3385 sequence = CTCTGTATATAAAAACAGAT Gene: RED65_00670: SOS-response repressor and protease LexA (EC 3.4.21.88)	* Oceanospirillum sp. MED92 Site: position = -87 score = 5.81849 sequence = CACTGTATAAAAAAACATTA Site: position = -28 score = 5.88033 sequence = TACTGTATAAACAACCAGAA Gene: MED92_03977: SOS-response repressor and protease LexA (EC 3.4.21.88)	* Marinomonas sp. MWYL1 Site: position = -44 score = 5.78284 sequence = TGCTGTATATAATAACAGTA Gene: Mmwyl1_2117: SOS-response repressor and protease LexA (EC 3.4.21.88)	* Saccharophagus degradans 2-40 Site: position = -41 score = 5.33276 sequence = TACTGTATATTCATCCAATC Gene: Sde_1787: SOS-response repressor and protease LexA (EC 3.4.21.88)	* Teredinibacter turnerae T7901 Site: position = -75 score = 6.06159 sequence = TACTGTATAAACAAACAGAT Gene: TERTU_1938: SOS-response repressor and protease LexA (EC 3.4.21.88)	* Cellvibrio japonicus Ueda107 Site: position = -32 score = 5.90669 sequence = AACTGTATAAATACACAGAA Gene: CJA_1697: SOS-response repressor and protease LexA (EC 3.4.21.88)	* Chromohalobacter salexigens DSM 3043 Site: position = -40 score = 4.83154 sequence = TACTGTATACTTGAACACGT Gene: Csal_2070: SOS-response repressor and protease LexA (EC 3.4.21.88)	* Reinekea sp. MED297 Site: position = -28 score = 5.75335 sequence = TACTGTATATATTAACAGGC Gene: MED297_16754: SOS-response repressor and protease LexA (EC 3.4.21.88)	* Alcanivorax borkumensis SK2 Site: position = -181 score = 4.20448 sequence = CACTGTTCTTATTGTCAGTA Gene: ABO_1009: SOS-response repressor and protease LexA (EC 3.4.21.88)	SOS-response repressor and protease LexA (EC 3.4.21.88)
sulA	Hahella chejuensis KCTC 2396	Marinobacter aqueolei Gene: Maqu_2006: Cell division inhibitor sulA	Marinobacter sp. ELB17 Gene: MELB17_18184: Cell division inhibitor sulA	Oceanobacter sp. RED65	Oceanospirillum sp. MED92 Gene: MED92_03972: Cell division inhibitor sulA	Marinomonas sp. MWYL1	Saccharophagus degradans 2-40 Gene: Sde_1786: Cell division inhibitor sulA	Teredinibacter turnerae T7901 Gene: TERTU_1937: Cell division inhibitor sulA	Cellvibrio japonicus Ueda107 Gene: CJA_1696: Cell division inhibitor sulA	Chromohalobacter salexigens DSM 3043	* Reinekea sp. MED297 Site: position = -30 score = 5.67469 sequence = TACTGTTTATTTATACAGGC Gene: MED297_16639: Cell division inhibitor sulA	Alcanivorax borkumensis SK2	Cell division inhibitor sulA
dinB	Hahella chejuensis KCTC 2396 Gene: HCH_04322: DNA polymerase IV (EC 2.7.7.7)	* Marinobacter aqueolei Site: position = -41 score = 5.06033 sequence = GGCTGTATAAACGTACAGAT Gene: Maqu_2332: DNA polymerase IV (EC 2.7.7.7)	* Marinobacter sp. ELB17 Site: position = -98 score = 4.74778 sequence = GGCTGTATGCATATACAGCG Gene: MELB17_18524: DNA polymerase IV (EC 2.7.7.7)	* Oceanobacter sp. RED65 Site: position = -28 score = 5.73513 sequence = CACTGTATGTTAATACAGTA Gene: RED65_10319: DNA polymerase IV (EC 2.7.7.7)	* Oceanospirillum sp. MED92 Site: position = -23 score = 6.48342 sequence = TACTGTATAAATAAACAGTA Gene: MED92_14483: DNA polymerase IV (EC 2.7.7.7)	* Marinomonas sp. MWYL1 Site: position = -37 score = 5.30042 sequence = AACTGTGTTTTTATACAGTA Gene: Mmwyl1_3784: DNA polymerase IV (EC 2.7.7.7)	Saccharophagus degradans 2-40 Gene: Sde_2507: DNA polymerase IV (EC 2.7.7.7)	* Teredinibacter turnerae T7901 Site: position = -68 score = 6.02968 sequence = AACTGTATAATAATACAGTA Gene: TERTU_0718: DNA polymerase IV (EC 2.7.7.7)	Cellvibrio japonicus Ueda107	Chromohalobacter salexigens DSM 3043 Gene: Csal_2071: DNA polymerase IV (EC 2.7.7.7)	* Reinekea sp. MED297 Site: position = -28 score = 5.38738 sequence = AACTGTATAAGCATACAGGT Gene: MED297_03315: DNA polymerase IV (EC 2.7.7.7)	Alcanivorax borkumensis SK2 Gene: ABO_0659: DNA polymerase IV (EC 2.7.7.7)	DNA polymerase IV (EC 2.7.7.7)

CRON 6.
yebG	* Hahella chejuensis KCTC 2396 Site: position = -42 score = 5.54789 sequence = AACTGTATGAATATACAGAG Gene: HCH_05148: SOS regulon DNA damage-inducible protein	* Marinobacter aqueolei Site: position = -88 score = 6.05806 sequence = TACTGTATAAATATACACTA Gene: Maqu_2961: SOS regulon DNA damage-inducible protein	* Marinobacter sp. ELB17 Site: position = -120 score = 6.06302 sequence = AACTGTATATATAAACAGTG Gene: MELB17_11410: SOS regulon DNA damage-inducible protein	Oceanobacter sp. RED65	Oceanospirillum sp. MED92	* Marinomonas sp. MWYL1 Site: position = -42 score = 6.20674 sequence = AACTGTATATTTATACAGTA Gene: Mmwyl1_3691: SOS regulon DNA damage-inducible protein	* Saccharophagus degradans 2-40 Site: position = -46 score = 5.27588 sequence = TACTGTATACTCGTACAGCA Gene: Sde_0674: SOS regulon DNA damage-inducible protein	* Teredinibacter turnerae T7901 Site: position = -88 score = 6.03377 sequence = TACTGTACAAACAAACAGTA Gene: TERTU_0430: SOS regulon DNA damage-inducible protein	Cellvibrio japonicus Ueda107 Gene: CJA_3220: SOS regulon DNA damage-inducible protein	Chromohalobacter salexigens DSM 3043	Reinekea sp. MED297	Alcanivorax borkumensis SK2	SOS regulon DNA damage-inducible protein

CRON 7.
uvrD	* Hahella chejuensis KCTC 2396 Site: position = -252 score = 4.97621 sequence = GGCTGTAAAATTATCCAGTA Gene: HCH_00743: ATP-dependent DNA helicase II	* Marinobacter aqueolei Site: position = -20 score = 4.97272 sequence = GGCTGTAAATTTAACCAGTA Gene: Maqu_3642: ATP-dependent DNA helicase II	* Marinobacter sp. ELB17 Site: position = -30 score = 5.23542 sequence = ACCTGTTTATTTAACCAGTA Gene: MELB17_02090: ATP-dependent DNA helicase II	Oceanobacter sp. RED65 Gene: RED65_15392: ATP-dependent DNA helicase II	* Oceanospirillum sp. MED92 Site: position = -34 score = 5.21094 sequence = CACTGATTATTTATACAGTG Gene: MED92_05258: ATP-dependent DNA helicase II	Marinomonas sp. MWYL1 Gene: Mmwyl1_4444: ATP-dependent DNA helicase II	* Saccharophagus degradans 2-40 Site: position = -61 score = 4.94092 sequence = TGCTGTCTATTTATACATGT Gene: Sde_3764: ATP-dependent DNA helicase II	Teredinibacter turnerae T7901 Gene: TERTU_4660: ATP-dependent DNA helicase II	Cellvibrio japonicus Ueda107 Gene: CJA_3566: ATP-dependent DNA helicase II	Chromohalobacter salexigens DSM 3043 Gene: Csal_3271: ATP-dependent DNA helicase II	* Reinekea sp. MED297 Site: position = -27 score = 5.06993 sequence = CCCTGTTTTTTTATACAGTT Gene: MED297_19917: ATP-dependent DNA helicase II	Alcanivorax borkumensis SK2 Gene: ABO_2690: ATP-dependent DNA helicase II	ATP-dependent DNA helicase II

CRON 8.
ruvC	Hahella chejuensis KCTC 2396 Gene: HCH_04924: Crossover junction endodeoxyribonuclease RuvC (EC 3.1.22.4)	Marinobacter aqueolei Gene: Maqu_1706: Crossover junction endodeoxyribonuclease RuvC (EC 3.1.22.4)	Marinobacter sp. ELB17 Gene: MELB17_14703: Crossover junction endodeoxyribonuclease RuvC (EC 3.1.22.4)	Oceanobacter sp. RED65	* Oceanospirillum sp. MED92 Site: position = -30 score = 5.49555 sequence = GCCTGTATAAATAACCAGTA Gene: MED92_08737: Crossover junction endodeoxyribonuclease RuvC (EC 3.1.22.4)	* Marinomonas sp. MWYL1 Site: position = -43 score = 4.99567 sequence = GGCTGTTGAAATATACAGTA Gene: Mmwyl1_2188: Crossover junction endodeoxyribonuclease RuvC (EC 3.1.22.4)	Saccharophagus degradans 2-40 Gene: Sde_2535: Crossover junction endodeoxyribonuclease RuvC (EC 3.1.22.4)	Teredinibacter turnerae T7901 Gene: TERTU_3436: Crossover junction endodeoxyribonuclease RuvC (EC 3.1.22.4)	Cellvibrio japonicus Ueda107 Gene: CJA_1029: Crossover junction endodeoxyribonuclease RuvC (EC 3.1.22.4)	Chromohalobacter salexigens DSM 3043 Gene: Csal_1846: Crossover junction endodeoxyribonuclease RuvC (EC 3.1.22.4)	Reinekea sp. MED297 Gene: MED297_13812: Crossover junction endodeoxyribonuclease RuvC (EC 3.1.22.4)	Alcanivorax borkumensis SK2 Gene: ABO_0751: Crossover junction endodeoxyribonuclease RuvC (EC 3.1.22.4)	Crossover junction endodeoxyribonuclease RuvC (EC 3.1.22.4)
MED92_08742	Hahella chejuensis KCTC 2396 Gene: HCH_06086: Predicted inner membrane protein	Marinobacter aqueolei	Marinobacter sp. ELB17	Oceanobacter sp. RED65	Oceanospirillum sp. MED92 Gene: MED92_08742: Predicted inner membrane protein	Marinomonas sp. MWYL1	Saccharophagus degradans 2-40	Teredinibacter turnerae T7901	Cellvibrio japonicus Ueda107	Chromohalobacter salexigens DSM 3043 Gene: Csal_0350: Predicted inner membrane protein	Reinekea sp. MED297 Gene: MED297_13817: Predicted inner membrane protein	Alcanivorax borkumensis SK2	Predicted inner membrane protein
ruvA	Hahella chejuensis KCTC 2396 Gene: HCH_04923: Holliday junction DNA helicase RuvA	Marinobacter aqueolei Gene: Maqu_1705: Holliday junction DNA helicase RuvA	Marinobacter sp. ELB17 Gene: MELB17_14698: Holliday junction DNA helicase RuvA	* Oceanobacter sp. RED65 Site: position = -51 score = 5.32986 sequence = CACTGATTAAATTTACAGTA Gene: RED65_05144: Holliday junction DNA helicase RuvA	Oceanospirillum sp. MED92 Gene: MED92_08747: Holliday junction DNA helicase RuvA	Marinomonas sp. MWYL1 Gene: Mmwyl1_2189: Holliday junction DNA helicase RuvA	Saccharophagus degradans 2-40 Gene: Sde_2534: Holliday junction DNA helicase RuvA	Teredinibacter turnerae T7901 Gene: TERTU_3435: Holliday junction DNA helicase RuvA	Cellvibrio japonicus Ueda107 Gene: CJA_1030: Holliday junction DNA helicase RuvA	Chromohalobacter salexigens DSM 3043 Gene: Csal_1847: Holliday junction DNA helicase RuvA	Reinekea sp. MED297 Gene: MED297_13822: Holliday junction DNA helicase RuvA	Alcanivorax borkumensis SK2 Gene: ABO_0752: Holliday junction DNA helicase RuvA	Holliday junction DNA helicase RuvA
ruvB	Hahella chejuensis KCTC 2396 Gene: HCH_04922: Holliday junction DNA helicase RuvB	Marinobacter aqueolei Gene: Maqu_1704: Holliday junction DNA helicase RuvB	Marinobacter sp. ELB17 Gene: MELB17_14693: Holliday junction DNA helicase RuvB	Oceanobacter sp. RED65 Gene: RED65_05149: Holliday junction DNA helicase RuvB	Oceanospirillum sp. MED92 Gene: MED92_08752: Holliday junction DNA helicase RuvB	Marinomonas sp. MWYL1 Gene: Mmwyl1_2190: Holliday junction DNA helicase RuvB	Saccharophagus degradans 2-40 Gene: Sde_2533: Holliday junction DNA helicase RuvB	Teredinibacter turnerae T7901 Gene: TERTU_3434: Holliday junction DNA helicase RuvB	Cellvibrio japonicus Ueda107 Gene: CJA_1031: Holliday junction DNA helicase RuvB	Chromohalobacter salexigens DSM 3043 Gene: Csal_1848: Holliday junction DNA helicase RuvB	Reinekea sp. MED297 Gene: MED297_13827: Holliday junction DNA helicase RuvB	Alcanivorax borkumensis SK2 Gene: ABO_0753: Holliday junction DNA helicase RuvB	Holliday junction DNA helicase RuvB

CRON 9.
umuD	Hahella chejuensis KCTC 2396	* Marinobacter aqueolei Site: position = -33 score = 6.21868 sequence = TACTGTATATTCAAACAGTA Gene: Maqu_1208: DNA polymerase V, subunit UmuD	Marinobacter sp. ELB17	Oceanobacter sp. RED65	* Oceanospirillum sp. MED92 Site: position = -34 score = 6.454 sequence = TACTGTATATAAATACAGTA Gene: MED92_07246: DNA polymerase V, subunit UmuD	2 Marinomonas sp. MWYL1* Site: position = -35 score = 6.02799 sequence = TACTGTATATCTATACAGTA Gene: Mmwyl1_1981: DNA polymerase V, subunit UmuD Site: position = -34 score = 5.62457 sequence = TACTGTACGAATATACAGTC Gene: Mmwyl1_2469: DNA polymerase V, subunit UmuD	Saccharophagus degradans 2-40	Teredinibacter turnerae T7901	Cellvibrio japonicus Ueda107	Chromohalobacter salexigens DSM 3043	Reinekea sp. MED297	* Alcanivorax borkumensis SK2 Site: position = 20 score = 5.3988 sequence = TACTGTACATATAGGCAGTA Gene: ABO_1583: DNA polymerase V, subunit UmuD	DNA polymerase V, subunit UmuD
umuC	Hahella chejuensis KCTC 2396	Marinobacter aqueolei	Marinobacter sp. ELB17	Oceanobacter sp. RED65	Oceanospirillum sp. MED92 Gene: MED92_07251: DNA polymerase V, subunit UmuC	Marinomonas sp. MWYL1 Gene: Mmwyl1_1982: DNA polymerase V, subunit UmuC	Saccharophagus degradans 2-40	Teredinibacter turnerae T7901	Cellvibrio japonicus Ueda107	Chromohalobacter salexigens DSM 3043	Reinekea sp. MED297	Alcanivorax borkumensis SK2 Gene: ABO_1582: DNA polymerase V, subunit UmuC	DNA polymerase V, subunit UmuC

CRON 10.
PF04055	* Hahella chejuensis KCTC 2396 Site: position = -35 score = 6.04081 sequence = TACTGTACATTTAAACAGTA Gene: HCH_05408: DNA repair photolyase	Marinobacter aqueolei	Marinobacter sp. ELB17	Oceanobacter sp. RED65	Oceanospirillum sp. MED92	* Marinomonas sp. MWYL1 Site: position = -34 score = 6.0475 sequence = TACTGTTTATATATACAGCA Gene: Mmwyl1_0398: DNA repair photolyase	Saccharophagus degradans 2-40	Teredinibacter turnerae T7901	* Cellvibrio japonicus Ueda107 Site: position = 97 score = 5.70385 sequence = TACTGTATATGCATACAGAT Gene: CJA_3708: DNA repair photolyase	* Chromohalobacter salexigens DSM 3043 Site: position = -34 score = 5.58753 sequence = TACTGGCTATAAATACAGTA Gene: Csal_1500: DNA repair photolyase	Reinekea sp. MED297	* Alcanivorax borkumensis SK2 Site: position = -29 score = 5.80435 sequence = TACTGTACAAAAAGACAGTA Gene: ABO_1594: DNA repair photolyase	DNA repair photolyase

CRON 11.
intIA	Hahella chejuensis KCTC 2396	* Marinobacter aqueolei Site: position = -37 score = 5.89354 sequence = TACTGTATATTTATACATAA Gene: Maqu_0977: Integron integrase IntI4	Marinobacter sp. ELB17	Oceanobacter sp. RED65	Oceanospirillum sp. MED92	Marinomonas sp. MWYL1	* Saccharophagus degradans 2-40 Site: position = -36 score = 5.90898 sequence = TACTGTATATATAAACATAT Gene: Sde_0425: Integron integrase IntI4	* Teredinibacter turnerae T7901 Site: position = -32 score = 5.94306 sequence = TACTGTATGTACAAACAGTT Gene: TERTU_1758: Integron integrase IntI4	Cellvibrio japonicus Ueda107	Chromohalobacter salexigens DSM 3043	* Reinekea sp. MED297 Site: position = -45 score = 5.91247 sequence = TACTGTATAAATATACATAT Gene: MED297_04517: Integron integrase IntI4	Alcanivorax borkumensis SK2	Integron integrase IntI4

CRON 12.
topB	Hahella chejuensis KCTC 2396	Marinobacter aqueolei Gene: Maqu_2529: DNA topoisomerase III (EC 5.99.1.2)	Marinobacter sp. ELB17	Oceanobacter sp. RED65	* Oceanospirillum sp. MED92 Site: position = -26 score = 5.68333 sequence = TACTGTTTTTATATACAGTG Gene: MED92_11029: DNA topoisomerase III (EC 5.99.1.2)	* Marinomonas sp. MWYL1 Site: position = -29 score = 6.53147 sequence = TACTGTATATATAAACAGTA Gene: Mmwyl1_3275: DNA topoisomerase III (EC 5.99.1.2)	* Saccharophagus degradans 2-40 Site: position = -30 score = 5.34802 sequence = AGCTGTATATAACAACAGTA Gene: Sde_1542: DNA topoisomerase III (EC 5.99.1.2)	Teredinibacter turnerae T7901	Cellvibrio japonicus Ueda107	Chromohalobacter salexigens DSM 3043 Gene: Csal_2146: DNA topoisomerase III (EC 5.99.1.2)	Reinekea sp. MED297	Alcanivorax borkumensis SK2	DNA topoisomerase III (EC 5.99.1.2)

CRON 13.
uvrA	Hahella chejuensis KCTC 2396 Gene: HCH_06191: Excinuclease ABC subunit A	Marinobacter aqueolei Gene: Maqu_0746: Excinuclease ABC subunit A	Marinobacter sp. ELB17 Gene: MELB17_20071: Excinuclease ABC subunit A	Oceanobacter sp. RED65 Gene: RED65_16506: Excinuclease ABC subunit A	Oceanospirillum sp. MED92 Gene: MED92_18383: Excinuclease ABC subunit A	* Marinomonas sp. MWYL1 Site: position = -73 score = 5.68753 sequence = TACTGTAAAAATAGACAGTT Gene: Mmwyl1_4249: Excinuclease ABC subunit A	Saccharophagus degradans 2-40 Gene: Sde_0993: Excinuclease ABC subunit A	Teredinibacter turnerae T7901 Gene: TERTU_0942: Excinuclease ABC subunit A	Cellvibrio japonicus Ueda107 Gene: CJA_0726: Excinuclease ABC subunit A	Chromohalobacter salexigens DSM 3043 Gene: Csal_0448: Excinuclease ABC subunit A	* Reinekea sp. MED297 Site: position = -188 score = 5.68951 sequence = GACTGTACACATATACAGTA Gene: MED297_12852: Excinuclease ABC subunit A	* Alcanivorax borkumensis SK2 Site: position = -43 score = 4.69752 sequence = CCCTGTTCATTTTGACAGTA Gene: ABO_0427: Excinuclease ABC subunit A	Excinuclease ABC subunit A

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulog LexA - Oceanospirillales/Alteromonadales

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --