Regulon of LexA in Marinobacter aqueolei

Properties
Regulator type:	Transcription factor
TF locus tag:	Maqu_2007
Regulator family:	LexA
Regulation mode:	repressor
Biological process:	SOS response
Effector:	DNA damage
Regulog:	LexA - Oceanospirillales/Alteromonadales
Statistics of regulated genes:
- Genes	12
- Operons	9
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 91 sites [see more]

Member of regulog collections

By taxonomy - Oceanospirillales/Alteromonadales
By trascription factor - LexA
By TF family - LexA
By effector - DNA damage
By pathway - SOS response

Regulated operons
	Locus Tag	Name	Function
Position: -108 Score: 5.7 Sequence: TACTGTTCAAATATACAGGA Locus tag: Maqu_2082 Name: recA Funciton: Recombinase A
	Maqu_2082	recA	Recombinase A
Position: -42 Score: 5.9 Sequence: CACTGTATAAAAAAACAGGA Locus tag: Maqu_2007 Name: lexA Funciton: SOS-response repressor and protease LexA (EC 3.4.21.88) Locus tag: Maqu_2006 Name: sulA Funciton: Cell division inhibitor sulA
	Maqu_2007	lexA	SOS-response repressor and protease LexA (EC 3.4.21.88)
	Maqu_2006	sulA	Cell division inhibitor sulA
Position: -41 Score: 5.1 Sequence: GGCTGTATAAACGTACAGAT Locus tag: Maqu_2332 Name: dinB Funciton: DNA polymerase IV (EC 2.7.7.7)
	Maqu_2332	dinB	DNA polymerase IV (EC 2.7.7.7)
Position: -34 Score: 6.5 Sequence: TACTGTATATATAAACAGTA Locus tag: Maqu_0975 Name: imuA Funciton: Predicted RecA/RadA recombinase Locus tag: Maqu_0974 Name: imuB Funciton: DNA polymerase-like protein PA0670 Locus tag: Maqu_0973 Name: dnaE2 Funciton: DNA polymerase III alpha subunit (EC 2.7.7.7)
	Maqu_0975	imuA	Predicted RecA/RadA recombinase
	Maqu_0974	imuB	DNA polymerase-like protein PA0670
	Maqu_0973	dnaE2	DNA polymerase III alpha subunit (EC 2.7.7.7)
Position: -62 Score: 5.8 Sequence: CACTGTATGAAAAAACAGTA Locus tag: Maqu_3364 Name: recN Funciton: DNA repair protein RecN
	Maqu_3364	recN	DNA repair protein RecN
Position: -88 Score: 6.1 Sequence: TACTGTATAAATATACACTA Locus tag: Maqu_2961 Name: yebG Funciton: SOS regulon DNA damage-inducible protein
	Maqu_2961	yebG	SOS regulon DNA damage-inducible protein
Position: -20 Score: 5 Sequence: GGCTGTAAATTTAACCAGTA Locus tag: Maqu_3642 Name: uvrD Funciton: ATP-dependent DNA helicase II
	Maqu_3642	uvrD	ATP-dependent DNA helicase II
Position: -33 Score: 6.2 Sequence: TACTGTATATTCAAACAGTA Locus tag: Maqu_1208 Name: umuD Funciton: DNA polymerase V, subunit UmuD
	Maqu_1208	umuD	DNA polymerase V, subunit UmuD
Position: -37 Score: 5.9 Sequence: TACTGTATATTTATACATAA Locus tag: Maqu_0977 Name: intIA Funciton: Integron integrase IntI4
	Maqu_0977	intIA	Integron integrase IntI4

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulon of LexA in Marinobacter aqueolei

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --