Regulon of LexA in Cellvibrio japonicus Ueda107

Properties
Regulator type:	Transcription factor
TF locus tag:	CJA_1697
Regulator family:	LexA
Regulation mode:	repressor
Biological process:	SOS response
Effector:	DNA damage
Regulog:	LexA - Oceanospirillales/Alteromonadales
Statistics of regulated genes:
- Genes	6
- Operons	4
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 91 sites [see more]

Member of regulog collections

By taxonomy - Oceanospirillales/Alteromonadales
By trascription factor - LexA
By TF family - LexA
By effector - DNA damage
By pathway - SOS response

Regulated operons
	Locus Tag	Name	Function
Position: -126 Score: 5.2 Sequence: CACTGTATAAATTACTAGTA Locus tag: CJA_2230 Name: recA Funciton: Recombinase A Locus tag: CJA_2228 Name: recX Funciton: Regulatory protein RecX
	CJA_2230	recA	Recombinase A
	CJA_2228	recX	Regulatory protein RecX
Position: -32 Score: 5.9 Sequence: AACTGTATAAATACACAGAA Locus tag: CJA_1697 Name: lexA Funciton: SOS-response repressor and protease LexA (EC 3.4.21.88) Locus tag: CJA_1696 Name: sulA Funciton: Cell division inhibitor sulA
	CJA_1697	lexA	SOS-response repressor and protease LexA (EC 3.4.21.88)
	CJA_1696	sulA	Cell division inhibitor sulA
Position: -49 Score: 5.8 Sequence: TACTGTATAAACAGACAGAT Locus tag: CJA_3351 Name: recN Funciton: DNA repair protein RecN
	CJA_3351	recN	DNA repair protein RecN
Position: 97 Score: 5.7 Sequence: TACTGTATATGCATACAGAT Locus tag: CJA_3708 Name: PF04055 Funciton: DNA repair photolyase
	CJA_3708	PF04055	DNA repair photolyase

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD