Regulon of LexA in Oceanospirillum sp. MED92

Properties
Regulator type:	Transcription factor
TF locus tag:	MED92_03977
Regulator family:	LexA
Regulation mode:	repressor
Biological process:	SOS response
Effector:	DNA damage
Regulog:	LexA - Oceanospirillales/Alteromonadales
Statistics of regulated genes:
- Genes	14
- Operons	8
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 91 sites [see more]

Member of regulog collections

By taxonomy - Oceanospirillales/Alteromonadales
By trascription factor - LexA
By TF family - LexA
By effector - DNA damage
By pathway - SOS response

Regulated operons
	Locus Tag	Name	Function
Position: -28 Score: 5.3 Sequence: CACTGTATAAAAACACATGT Locus tag: MED92_07346 Name: recN Funciton: DNA repair protein RecN
	MED92_07346	recN	DNA repair protein RecN
Position: -23 Score: 6.5 Sequence: TACTGTATAAATAAACAGTA Locus tag: MED92_14483 Name: dinB Funciton: DNA polymerase IV (EC 2.7.7.7)
	MED92_14483	dinB	DNA polymerase IV (EC 2.7.7.7)
Position: -87 Score: 5.8 Sequence: CACTGTATAAAAAAACATTA Position: -28 Score: 5.9 Sequence: TACTGTATAAACAACCAGAA Locus tag: MED92_03977 Name: lexA Funciton: SOS-response repressor and protease LexA (EC 3.4.21.88) Locus tag: MED92_03972 Name: sulA Funciton: Cell division inhibitor sulA
	MED92_03977	lexA	SOS-response repressor and protease LexA (EC 3.4.21.88)
	MED92_03972	sulA	Cell division inhibitor sulA
Position: -61 Score: 5.7 Sequence: TACTGTCCATACATACAGTA Locus tag: MED92_08116 Name: recA Funciton: Recombinase A Locus tag: MED92_08121 Name: recX Funciton: Regulatory protein RecX
	MED92_08116	recA	Recombinase A
	MED92_08121	recX	Regulatory protein RecX
Position: -34 Score: 5.2 Sequence: CACTGATTATTTATACAGTG Locus tag: MED92_05258 Name: uvrD Funciton: ATP-dependent DNA helicase II
	MED92_05258	uvrD	ATP-dependent DNA helicase II
Position: -30 Score: 5.5 Sequence: GCCTGTATAAATAACCAGTA Locus tag: MED92_08737 Name: ruvC Funciton: Crossover junction endodeoxyribonuclease RuvC (EC 3.1.22.4) Locus tag: MED92_08742 Name: MED92_08742 Funciton: Predicted inner membrane protein Locus tag: MED92_08747 Name: ruvA Funciton: Holliday junction DNA helicase RuvA Locus tag: MED92_08752 Name: ruvB Funciton: Holliday junction DNA helicase RuvB
	MED92_08737	ruvC	Crossover junction endodeoxyribonuclease RuvC (EC 3.1.22.4)
	MED92_08742	MED92_08742	Predicted inner membrane protein
	MED92_08747	ruvA	Holliday junction DNA helicase RuvA
	MED92_08752	ruvB	Holliday junction DNA helicase RuvB
Position: -34 Score: 6.5 Sequence: TACTGTATATAAATACAGTA Locus tag: MED92_07246 Name: umuD Funciton: DNA polymerase V, subunit UmuD Locus tag: MED92_07251 Name: umuC Funciton: DNA polymerase V, subunit UmuC
	MED92_07246	umuD	DNA polymerase V, subunit UmuD
	MED92_07251	umuC	DNA polymerase V, subunit UmuC
Position: -26 Score: 5.7 Sequence: TACTGTTTTTATATACAGTG Locus tag: MED92_11029 Name: topB Funciton: DNA topoisomerase III (EC 5.99.1.2)
	MED92_11029	topB	DNA topoisomerase III (EC 5.99.1.2)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulon of LexA in Oceanospirillum sp. MED92

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --