Regulon of LexA in Saccharophagus degradans 2-40

Properties
Regulator type:	Transcription factor
TF locus tag:	Sde_1787
Regulator family:	LexA
Regulation mode:	repressor
Biological process:	SOS response
Effector:	DNA damage
Regulog:	LexA - Oceanospirillales/Alteromonadales
Statistics of regulated genes:
- Genes	11
- Operons	8
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 91 sites [see more]

Member of regulog collections

By taxonomy - Oceanospirillales/Alteromonadales
By trascription factor - LexA
By TF family - LexA
By effector - DNA damage
By pathway - SOS response

Regulated operons
	Locus Tag	Name	Function
Position: -163 Score: 5.2 Sequence: TACTGTATAAAAAACTATTA Locus tag: Sde_1288 Name: recA Funciton: Recombinase A Locus tag: Sde_1289 Name: recX Funciton: Regulatory protein RecX
	Sde_1288	recA	Recombinase A
	Sde_1289	recX	Regulatory protein RecX
Position: -41 Score: 5.3 Sequence: TACTGTATATTCATCCAATC Locus tag: Sde_1787 Name: lexA Funciton: SOS-response repressor and protease LexA (EC 3.4.21.88) Locus tag: Sde_1786 Name: sulA Funciton: Cell division inhibitor sulA
	Sde_1787	lexA	SOS-response repressor and protease LexA (EC 3.4.21.88)
	Sde_1786	sulA	Cell division inhibitor sulA
Position: -38 Score: 5.7 Sequence: TACTGTATAGACATACAGCA Locus tag: Sde_1030 Name: imuA Funciton: Predicted RecA/RadA recombinase Locus tag: Sde_1029 Name: imuB Funciton: DNA polymerase-like protein PA0670
	Sde_1030	imuA	Predicted RecA/RadA recombinase
	Sde_1029	imuB	DNA polymerase-like protein PA0670
Position: -43 Score: 5.2 Sequence: CACTGTATAAATAACCATAC Locus tag: Sde_2735 Name: recN Funciton: DNA repair protein RecN
	Sde_2735	recN	DNA repair protein RecN
Position: -46 Score: 5.3 Sequence: TACTGTATACTCGTACAGCA Locus tag: Sde_0674 Name: yebG Funciton: SOS regulon DNA damage-inducible protein
	Sde_0674	yebG	SOS regulon DNA damage-inducible protein
Position: -61 Score: 4.9 Sequence: TGCTGTCTATTTATACATGT Locus tag: Sde_3764 Name: uvrD Funciton: ATP-dependent DNA helicase II
	Sde_3764	uvrD	ATP-dependent DNA helicase II
Position: -36 Score: 5.9 Sequence: TACTGTATATATAAACATAT Locus tag: Sde_0425 Name: intIA Funciton: Integron integrase IntI4
	Sde_0425	intIA	Integron integrase IntI4
Position: -30 Score: 5.3 Sequence: AGCTGTATATAACAACAGTA Locus tag: Sde_1542 Name: topB Funciton: DNA topoisomerase III (EC 5.99.1.2)
	Sde_1542	topB	DNA topoisomerase III (EC 5.99.1.2)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD