Regulon of LexA in Chromohalobacter salexigens DSM 3043

Properties
Regulator type:	Transcription factor
TF locus tag:	Csal_2070
Regulator family:	LexA
Regulation mode:	repressor
Biological process:	SOS response
Effector:	DNA damage
Regulog:	LexA - Oceanospirillales/Alteromonadales
Statistics of regulated genes:
- Genes	6
- Operons	4
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 91 sites [see more]

Member of regulog collections

By taxonomy - Oceanospirillales/Alteromonadales
By trascription factor - LexA
By TF family - LexA
By effector - DNA damage
By pathway - SOS response

Regulated operons
	Locus Tag	Name	Function
Position: -90 Score: 5 Sequence: TACTGGCTAGTCATACAGTA Locus tag: Csal_0623 Name: recA Funciton: Recombinase A Locus tag: Csal_0624 Name: recX Funciton: Regulatory protein RecX
	Csal_0623	recA	Recombinase A
	Csal_0624	recX	Regulatory protein RecX
Position: -52 Score: 5.7 Sequence: TACTGTATAAACACACAGAG Locus tag: Csal_3096 Name: recN Funciton: DNA repair protein RecN
	Csal_3096	recN	DNA repair protein RecN
Position: -40 Score: 4.8 Sequence: TACTGTATACTTGAACACGT Locus tag: Csal_2070 Name: lexA Funciton: SOS-response repressor and protease LexA (EC 3.4.21.88) Locus tag: Csal_2071 Name: dinB Funciton: DNA polymerase IV (EC 2.7.7.7)
	Csal_2070	lexA	SOS-response repressor and protease LexA (EC 3.4.21.88)
	Csal_2071	dinB	DNA polymerase IV (EC 2.7.7.7)
Position: -34 Score: 5.6 Sequence: TACTGGCTATAAATACAGTA Locus tag: Csal_1500 Name: PF04055 Funciton: DNA repair photolyase
	Csal_1500	PF04055	DNA repair photolyase

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD