Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing Sde_0008 gene

Properties
Regulog: LexA - Oceanospirillales/Alteromonadales
Regulator type: Transcription factor
Regulator family: LexA
Regulation mode: repressor
Biological process: SOS response
Effector: DNA damage
Phylum: Proteobacteria/gamma
Built upon 91 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Alcanivorax borkumensis SK2
Position: -40
Score: 4.29608
Sequence: CACTGACCATAAGAACAGTC
Locus tag: ABO_0311
Name: Sde_0008
Funciton: Conserved hypothetical protein
Locus tag: ABO_0310
Name: recN
Funciton: DNA repair protein RecN
Sde_0008-recN -40 4.3 CACTGACCATAAGAACAGTC ABO_0311