Regulon of LexA in Marinomonas sp. MWYL1

Properties
Regulator type:	Transcription factor
TF locus tag:	Mmwyl1_2117
Regulator family:	LexA
Regulation mode:	repressor
Biological process:	SOS response
Effector:	DNA damage
Regulog:	LexA - Oceanospirillales/Alteromonadales
Statistics of regulated genes:
- Genes	14
- Operons	11
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 91 sites [see more]

Member of regulog collections

By taxonomy - Oceanospirillales/Alteromonadales
By trascription factor - LexA
By TF family - LexA
By effector - DNA damage
By pathway - SOS response

Regulated operons
	Locus Tag	Name	Function
Position: -87 Score: 6 Sequence: TACTGTTTTTATATACAGTA Locus tag: Mmwyl1_3732 Name: recA Funciton: Recombinase A
	Mmwyl1_3732	recA	Recombinase A
Position: -50 Score: 5.6 Sequence: TACTGTATAAATAACCATAT Locus tag: Mmwyl1_3966 Name: recN Funciton: DNA repair protein RecN
	Mmwyl1_3966	recN	DNA repair protein RecN
Position: -37 Score: 5.3 Sequence: AACTGTGTTTTTATACAGTA Locus tag: Mmwyl1_3784 Name: dinB Funciton: DNA polymerase IV (EC 2.7.7.7)
	Mmwyl1_3784	dinB	DNA polymerase IV (EC 2.7.7.7)
Position: -44 Score: 5.8 Sequence: TGCTGTATATAATAACAGTA Locus tag: Mmwyl1_2117 Name: lexA Funciton: SOS-response repressor and protease LexA (EC 3.4.21.88)
	Mmwyl1_2117	lexA	SOS-response repressor and protease LexA (EC 3.4.21.88)
Position: -42 Score: 6.2 Sequence: AACTGTATATTTATACAGTA Locus tag: Mmwyl1_3691 Name: yebG Funciton: SOS regulon DNA damage-inducible protein
	Mmwyl1_3691	yebG	SOS regulon DNA damage-inducible protein
Position: -43 Score: 5 Sequence: GGCTGTTGAAATATACAGTA Locus tag: Mmwyl1_2188 Name: ruvC Funciton: Crossover junction endodeoxyribonuclease RuvC (EC 3.1.22.4) Locus tag: Mmwyl1_2189 Name: ruvA Funciton: Holliday junction DNA helicase RuvA Locus tag: Mmwyl1_2190 Name: ruvB Funciton: Holliday junction DNA helicase RuvB
	Mmwyl1_2188	ruvC	Crossover junction endodeoxyribonuclease RuvC (EC 3.1.22.4)
	Mmwyl1_2189	ruvA	Holliday junction DNA helicase RuvA
	Mmwyl1_2190	ruvB	Holliday junction DNA helicase RuvB
Position: -35 Score: 6 Sequence: TACTGTATATCTATACAGTA Locus tag: Mmwyl1_1981 Name: umuD Funciton: DNA polymerase V, subunit UmuD Locus tag: Mmwyl1_1982 Name: umuC Funciton: DNA polymerase V, subunit UmuC
	Mmwyl1_1981	umuD	DNA polymerase V, subunit UmuD
	Mmwyl1_1982	umuC	DNA polymerase V, subunit UmuC
Position: -34 Score: 5.6 Sequence: TACTGTACGAATATACAGTC Locus tag: Mmwyl1_2469 Name: umuD Funciton: DNA polymerase V, subunit UmuD
	Mmwyl1_2469	umuD	DNA polymerase V, subunit UmuD
Position: -34 Score: 6 Sequence: TACTGTTTATATATACAGCA Locus tag: Mmwyl1_0398 Name: PF04055 Funciton: DNA repair photolyase
	Mmwyl1_0398	PF04055	DNA repair photolyase
Position: -29 Score: 6.5 Sequence: TACTGTATATATAAACAGTA Locus tag: Mmwyl1_3275 Name: topB Funciton: DNA topoisomerase III (EC 5.99.1.2)
	Mmwyl1_3275	topB	DNA topoisomerase III (EC 5.99.1.2)
Position: -73 Score: 5.7 Sequence: TACTGTAAAAATAGACAGTT Locus tag: Mmwyl1_4249 Name: uvrA Funciton: Excinuclease ABC subunit A
	Mmwyl1_4249	uvrA	Excinuclease ABC subunit A

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulon of LexA in Marinomonas sp. MWYL1

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --