Regulon of LexA in Teredinibacter turnerae T7901

Properties
Regulator type:	Transcription factor
TF locus tag:	TERTU_1938
Regulator family:	LexA
Regulation mode:	repressor
Biological process:	SOS response
Effector:	DNA damage
Regulog:	LexA - Oceanospirillales/Alteromonadales
Statistics of regulated genes:
- Genes	10
- Operons	8
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 91 sites [see more]

Member of regulog collections

By taxonomy - Oceanospirillales/Alteromonadales
By trascription factor - LexA
By TF family - LexA
By effector - DNA damage
By pathway - SOS response

Regulated operons
	Locus Tag	Name	Function
Position: -242 Score: 5.3 Sequence: CACTGTTTACACGTACAGTA Locus tag: TERTU_2823 Name: recA Funciton: Recombinase A
	TERTU_2823	recA	Recombinase A
Position: -75 Score: 6.1 Sequence: TACTGTATAAACAAACAGAT Locus tag: TERTU_1938 Name: lexA Funciton: SOS-response repressor and protease LexA (EC 3.4.21.88) Locus tag: TERTU_1937 Name: sulA Funciton: Cell division inhibitor sulA
	TERTU_1938	lexA	SOS-response repressor and protease LexA (EC 3.4.21.88)
	TERTU_1937	sulA	Cell division inhibitor sulA
Position: -68 Score: 6 Sequence: AACTGTATAATAATACAGTA Locus tag: TERTU_0718 Name: dinB Funciton: DNA polymerase IV (EC 2.7.7.7)
	TERTU_0718	dinB	DNA polymerase IV (EC 2.7.7.7)
Position: -30 Score: 5.9 Sequence: AACTGTATATTTAAACAGCA Locus tag: TERTU_2929 Name: dnaE2 Funciton: DNA polymerase III alpha subunit (EC 2.7.7.7)
	TERTU_2929	dnaE2	DNA polymerase III alpha subunit (EC 2.7.7.7)
Position: -37 Score: 6.2 Sequence: TACTGTATATTAATACAGTT Locus tag: TERTU_2925 Name: imuA Funciton: Predicted RecA/RadA recombinase Locus tag: TERTU_2926 Name: imuB Funciton: DNA polymerase-like protein PA0670
	TERTU_2925	imuA	Predicted RecA/RadA recombinase
	TERTU_2926	imuB	DNA polymerase-like protein PA0670
Position: -65 Score: 5.6 Sequence: TACTGTATAAATAGCCAATA Locus tag: TERTU_3298 Name: recN Funciton: DNA repair protein RecN
	TERTU_3298	recN	DNA repair protein RecN
Position: -88 Score: 6 Sequence: TACTGTACAAACAAACAGTA Locus tag: TERTU_0430 Name: yebG Funciton: SOS regulon DNA damage-inducible protein
	TERTU_0430	yebG	SOS regulon DNA damage-inducible protein
Position: -32 Score: 5.9 Sequence: TACTGTATGTACAAACAGTT Locus tag: TERTU_1758 Name: intIA Funciton: Integron integrase IntI4
	TERTU_1758	intIA	Integron integrase IntI4

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD