Regulon of LexA in Reinekea sp. MED297

Properties
Regulator type:	Transcription factor
TF locus tag:	MED297_16754
Regulator family:	LexA
Regulation mode:	repressor
Biological process:	SOS response
Effector:	DNA damage
Regulog:	LexA - Oceanospirillales/Alteromonadales
Statistics of regulated genes:
- Genes	12
- Operons	9
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 91 sites [see more]

Member of regulog collections

By taxonomy - Oceanospirillales/Alteromonadales
By trascription factor - LexA
By TF family - LexA
By effector - DNA damage
By pathway - SOS response

Regulated operons
	Locus Tag	Name	Function
Position: -31 Score: 5 Sequence: TACTGGTCATTCATACAGCA Locus tag: MED297_13572 Name: recA Funciton: Recombinase A Locus tag: MED297_13577 Name: recX Funciton: Regulatory protein RecX
	MED297_13572	recA	Recombinase A
	MED297_13577	recX	Regulatory protein RecX
Position: -35 Score: 6.3 Sequence: TACTGTATATACATACAGTT Locus tag: MED297_04849 Name: imuA Funciton: Predicted RecA/RadA recombinase Locus tag: MED297_04854 Name: imuB Funciton: DNA polymerase-like protein PA0670 Locus tag: MED297_04859 Name: dnaE2 Funciton: DNA polymerase III alpha subunit (EC 2.7.7.7)
	MED297_04849	imuA	Predicted RecA/RadA recombinase
	MED297_04854	imuB	DNA polymerase-like protein PA0670
	MED297_04859	dnaE2	DNA polymerase III alpha subunit (EC 2.7.7.7)
Position: -82 Score: 5.8 Sequence: AACTGTATATATATACATAT Locus tag: MED297_09676 Name: recN Funciton: DNA repair protein RecN
	MED297_09676	recN	DNA repair protein RecN
Position: -30 Score: 5.7 Sequence: TACTGTTTATTTATACAGGC Locus tag: MED297_16639 Name: sulA Funciton: Cell division inhibitor sulA
	MED297_16639	sulA	Cell division inhibitor sulA
Position: -28 Score: 5.8 Sequence: TACTGTATATATTAACAGGC Locus tag: MED297_16754 Name: lexA Funciton: SOS-response repressor and protease LexA (EC 3.4.21.88)
	MED297_16754	lexA	SOS-response repressor and protease LexA (EC 3.4.21.88)
Position: -28 Score: 5.4 Sequence: AACTGTATAAGCATACAGGT Locus tag: MED297_03315 Name: dinB Funciton: DNA polymerase IV (EC 2.7.7.7)
	MED297_03315	dinB	DNA polymerase IV (EC 2.7.7.7)
Position: -27 Score: 5.1 Sequence: CCCTGTTTTTTTATACAGTT Locus tag: MED297_19917 Name: uvrD Funciton: ATP-dependent DNA helicase II
	MED297_19917	uvrD	ATP-dependent DNA helicase II
Position: -45 Score: 5.9 Sequence: TACTGTATAAATATACATAT Locus tag: MED297_04517 Name: intIA Funciton: Integron integrase IntI4
	MED297_04517	intIA	Integron integrase IntI4
Position: -188 Score: 5.7 Sequence: GACTGTACACATATACAGTA Locus tag: MED297_12852 Name: uvrA Funciton: Excinuclease ABC subunit A
	MED297_12852	uvrA	Excinuclease ABC subunit A

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulon of LexA in Reinekea sp. MED297

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --