Regulon of LexA in Alcanivorax borkumensis SK2

Properties
Regulator type:	Transcription factor
TF locus tag:	ABO_1009
Regulator family:	LexA
Regulation mode:	repressor
Biological process:	SOS response
Effector:	DNA damage
Regulog:	LexA - Oceanospirillales/Alteromonadales
Statistics of regulated genes:
- Genes	9
- Operons	6
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 91 sites [see more]

Member of regulog collections

By taxonomy - Oceanospirillales/Alteromonadales
By trascription factor - LexA
By TF family - LexA
By effector - DNA damage
By pathway - SOS response

Regulated operons
	Locus Tag	Name	Function
Position: -109 Score: 4.3 Sequence: TACTGTCCATAACGCCAGTG Locus tag: ABO_1801 Name: recA Funciton: Recombinase A Locus tag: ABO_1800 Name: recX Funciton: Regulatory protein RecX
	ABO_1801	recA	Recombinase A
	ABO_1800	recX	Regulatory protein RecX
Position: -40 Score: 4.3 Sequence: CACTGACCATAAGAACAGTC Locus tag: ABO_0311 Name: Sde_0008 Funciton: Conserved hypothetical protein Locus tag: ABO_0310 Name: recN Funciton: DNA repair protein RecN
	ABO_0311	Sde_0008	Conserved hypothetical protein
	ABO_0310	recN	DNA repair protein RecN
Position: -181 Score: 4.2 Sequence: CACTGTTCTTATTGTCAGTA Locus tag: ABO_1009 Name: lexA Funciton: SOS-response repressor and protease LexA (EC 3.4.21.88)
	ABO_1009	lexA	SOS-response repressor and protease LexA (EC 3.4.21.88)
Position: 20 Score: 5.4 Sequence: TACTGTACATATAGGCAGTA Locus tag: ABO_1583 Name: umuD Funciton: DNA polymerase V, subunit UmuD Locus tag: ABO_1582 Name: umuC Funciton: DNA polymerase V, subunit UmuC
	ABO_1583	umuD	DNA polymerase V, subunit UmuD
	ABO_1582	umuC	DNA polymerase V, subunit UmuC
Position: -29 Score: 5.8 Sequence: TACTGTACAAAAAGACAGTA Locus tag: ABO_1594 Name: PF04055 Funciton: DNA repair photolyase
	ABO_1594	PF04055	DNA repair photolyase
Position: -43 Score: 4.7 Sequence: CCCTGTTCATTTTGACAGTA Locus tag: ABO_0427 Name: uvrA Funciton: Excinuclease ABC subunit A
	ABO_0427	uvrA	Excinuclease ABC subunit A

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD