Regulon of LexA in Marinobacter sp. ELB17

Properties
Regulator type:	Transcription factor
TF locus tag:	MELB17_18189
Regulator family:	LexA
Regulation mode:	repressor
Biological process:	SOS response
Effector:	DNA damage
Regulog:	LexA - Oceanospirillales/Alteromonadales
Statistics of regulated genes:
- Genes	10
- Operons	7
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 91 sites [see more]

Member of regulog collections

By taxonomy - Oceanospirillales/Alteromonadales
By trascription factor - LexA
By TF family - LexA
By effector - DNA damage
By pathway - SOS response

Regulated operons
	Locus Tag	Name	Function
Position: -142 Score: 5.3 Sequence: TGCTGGTTAAATATACAGTG Locus tag: MELB17_08004 Name: recA Funciton: Recombinase A
	MELB17_08004	recA	Recombinase A
Position: -35 Score: 6.5 Sequence: TACTGTATATATAAACAGTA Locus tag: MELB17_15581 Name: imuA Funciton: Predicted RecA/RadA recombinase Locus tag: MELB17_15586 Name: imuB Funciton: DNA polymerase-like protein PA0670 Locus tag: MELB17_15591 Name: dnaE2 Funciton: DNA polymerase III alpha subunit (EC 2.7.7.7)
	MELB17_15581	imuA	Predicted RecA/RadA recombinase
	MELB17_15586	imuB	DNA polymerase-like protein PA0670
	MELB17_15591	dnaE2	DNA polymerase III alpha subunit (EC 2.7.7.7)
Position: -46 Score: 5.8 Sequence: CACTGTATGAAAAAACAGTA Locus tag: MELB17_03505 Name: recN Funciton: DNA repair protein RecN
	MELB17_03505	recN	DNA repair protein RecN
Position: -98 Score: 4.7 Sequence: GGCTGTATGCATATACAGCG Locus tag: MELB17_18524 Name: dinB Funciton: DNA polymerase IV (EC 2.7.7.7)
	MELB17_18524	dinB	DNA polymerase IV (EC 2.7.7.7)
Position: -47 Score: 5.6 Sequence: CACTGTATAAACAAACAGGG Locus tag: MELB17_18189 Name: lexA Funciton: SOS-response repressor and protease LexA (EC 3.4.21.88) Locus tag: MELB17_18184 Name: sulA Funciton: Cell division inhibitor sulA
	MELB17_18189	lexA	SOS-response repressor and protease LexA (EC 3.4.21.88)
	MELB17_18184	sulA	Cell division inhibitor sulA
Position: -120 Score: 6.1 Sequence: AACTGTATATATAAACAGTG Locus tag: MELB17_11410 Name: yebG Funciton: SOS regulon DNA damage-inducible protein
	MELB17_11410	yebG	SOS regulon DNA damage-inducible protein
Position: -30 Score: 5.2 Sequence: ACCTGTTTATTTAACCAGTA Locus tag: MELB17_02090 Name: uvrD Funciton: ATP-dependent DNA helicase II
	MELB17_02090	uvrD	ATP-dependent DNA helicase II

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD