Statistics of regulated genes

Genome	Genes	Operons
Rhodobacter sphaeroides 2.4.1	2	2
Paracoccus denitrificans PD1222
Jannaschia sp. CCS1	14	3
Rhodobacterales bacterium HTCC2654	4	3
Oceanicola granulosus HTCC2516	10	1
Loktanella vestfoldensis SKA53	11	4
Oceanicola batsensis HTCC2597	12	3
Roseovarius nubinhibens ISM	16	4
Roseovarius sp. 217	13	4
Sulfitobacter sp. EE-36	13	4
Silicibacter TM1040	12	3
Silicibacter pomeroyi DSS-3	4	4
Roseobacter sp. MED193	12	2
Hyphomonas neptunium ATCC 15444
Oceanicaulis alexandrii HTCC2633

Clusters of co-Regulated Orthologous operoNs (CRONs)

Genes																Function
CRON 1.
iscR	Rhodobacter sphaeroides 2.4.1 Gene: RSP_0443: Iron-sulfur cluster regulator IscR	Paracoccus denitrificans PD1222 Gene: Pden_2958: Iron-sulfur cluster regulator IscR	* Jannaschia sp. CCS1 Site: position = -137 score = 5.18857 sequence = ACCCTAGAACGATTCCAAATT Gene: Jann_2366: Iron-sulfur cluster regulator IscR	Rhodobacterales bacterium HTCC2654 Gene: RB2654_04009: Iron-sulfur cluster regulator IscR	* Oceanicola granulosus HTCC2516 Site: position = -131 score = 6.318 sequence = TGTTTAGAAGTGTTCTAAACT Gene: OG2516_03700: Iron-sulfur cluster regulator IscR	* Loktanella vestfoldensis SKA53 Site: position = -111 score = 5.86635 sequence = ACCTTAGAAGGATTCTAAACT Gene: SKA53_05183: Iron-sulfur cluster regulator IscR	* Oceanicola batsensis HTCC2597 Site: position = -114 score = 5.03496 sequence = ACCTTAGAAAGATTCTAAAGC Gene: OB2597_03589: Iron-sulfur cluster regulator IscR	* Roseovarius nubinhibens ISM Site: position = -129 score = 6.34207 sequence = ACTTTAGAACTGTTCTAAACA Gene: ISM_16015: Iron-sulfur cluster regulator IscR	* Roseovarius sp. 217 Site: position = -100 score = 5.96286 sequence = ACCTTAGAACTGTTCTAAATT Gene: ROS217_20542: Iron-sulfur cluster regulator IscR	* Sulfitobacter sp. EE-36 Site: position = -116 score = 5.90335 sequence = AGTTTAGAACGGTTCTAACTT Gene: EE36_14302: Iron-sulfur cluster regulator IscR	* Silicibacter TM1040 Site: position = -117 score = 5.69427 sequence = ACCTTAGAACTGTTCTAAAGA Gene: TM1040_1240: Iron-sulfur cluster regulator IscR	* Silicibacter pomeroyi DSS-3 Site: position = -121 score = 5.24073 sequence = ATCTTAGAATGGTTCTAAGTC Gene: SPO2025: Iron-sulfur cluster regulator IscR	* Roseobacter sp. MED193 Site: position = -124 score = 5.31165 sequence = ATCTTAGAACAATTCTAATTG Gene: MED193_04321: Iron-sulfur cluster regulator IscR	Hyphomonas neptunium ATCC 15444	Oceanicaulis alexandrii HTCC2633 Gene: OA2633_03246: Iron-sulfur cluster regulator IscR	Iron-sulfur cluster regulator IscR
sufS	Rhodobacter sphaeroides 2.4.1 Gene: RSP_0442: Cysteine desulfurase (EC 2.8.1.7)	Paracoccus denitrificans PD1222 Gene: Pden_3963: Cysteine desulfurase (EC 2.8.1.7)	Jannaschia sp. CCS1 Gene: Jann_2365: Cysteine desulfurase (EC 2.8.1.7)	Rhodobacterales bacterium HTCC2654 Gene: RB2654_04004: Cysteine desulfurase (EC 2.8.1.7)	Oceanicola granulosus HTCC2516 Gene: OG2516_03695: Cysteine desulfurase (EC 2.8.1.7)	Loktanella vestfoldensis SKA53 Gene: SKA53_05178: Cysteine desulfurase (EC 2.8.1.7)	Oceanicola batsensis HTCC2597 Gene: OB2597_03584: Cysteine desulfurase (EC 2.8.1.7)	Roseovarius nubinhibens ISM Gene: ISM_16010: Cysteine desulfurase (EC 2.8.1.7)	Roseovarius sp. 217 Gene: ROS217_20537: Cysteine desulfurase (EC 2.8.1.7)	Sulfitobacter sp. EE-36 Gene: EE36_14307: Cysteine desulfurase (EC 2.8.1.7)	Silicibacter TM1040 Gene: TM1040_1241: Cysteine desulfurase (EC 2.8.1.7)	Silicibacter pomeroyi DSS-3	Roseobacter sp. MED193 Gene: MED193_04316: Cysteine desulfurase (EC 2.8.1.7)	Hyphomonas neptunium ATCC 15444 Gene: HNE_2620: Cysteine desulfurase (EC 2.8.1.7)	Oceanicaulis alexandrii HTCC2633 Gene: OA2633_03241: Cysteine desulfurase (EC 2.8.1.7)	Cysteine desulfurase (EC 2.8.1.7)
sufB	Rhodobacter sphaeroides 2.4.1 Gene: RSP_0440: Iron-sulfur assembly protein SufB	Paracoccus denitrificans PD1222 Gene: Pden_3964: Iron-sulfur assembly protein SufB	Jannaschia sp. CCS1 Gene: Jann_2364: Iron-sulfur assembly protein SufB	Rhodobacterales bacterium HTCC2654 Gene: RB2654_03999: Iron-sulfur assembly protein SufB	Oceanicola granulosus HTCC2516 Gene: OG2516_03690: Iron-sulfur assembly protein SufB	Loktanella vestfoldensis SKA53 Gene: SKA53_05173: Iron-sulfur assembly protein SufB	Oceanicola batsensis HTCC2597 Gene: OB2597_03579: Iron-sulfur assembly protein SufB	Roseovarius nubinhibens ISM Gene: ISM_16005: Iron-sulfur assembly protein SufB	Roseovarius sp. 217 Gene: ROS217_20532: Iron-sulfur assembly protein SufB	Sulfitobacter sp. EE-36 Gene: EE36_14312: Iron-sulfur assembly protein SufB	Silicibacter TM1040 Gene: TM1040_1242: Iron-sulfur assembly protein SufB	Silicibacter pomeroyi DSS-3 Gene: SPO2023: Iron-sulfur assembly protein SufB	Roseobacter sp. MED193 Gene: MED193_04311: Iron-sulfur assembly protein SufB	Hyphomonas neptunium ATCC 15444 Gene: HNE_2619: Iron-sulfur assembly protein SufB	Oceanicaulis alexandrii HTCC2633 Gene: OA2633_03236: Iron-sulfur assembly protein SufB	Iron-sulfur assembly protein SufB
ISM_16000	Rhodobacter sphaeroides 2.4.1	Paracoccus denitrificans PD1222	Jannaschia sp. CCS1	Rhodobacterales bacterium HTCC2654	Oceanicola granulosus HTCC2516	Loktanella vestfoldensis SKA53	Oceanicola batsensis HTCC2597	Roseovarius nubinhibens ISM Gene: ISM_16000: hypothetical protein	Roseovarius sp. 217	Sulfitobacter sp. EE-36	Silicibacter TM1040	Silicibacter pomeroyi DSS-3	Roseobacter sp. MED193	Hyphomonas neptunium ATCC 15444	Oceanicaulis alexandrii HTCC2633	hypothetical protein
PF02475	Rhodobacter sphaeroides 2.4.1	Paracoccus denitrificans PD1222	2 Jannaschia sp. CCS1 Gene: Jann_2362: Methyltransferase FkbM Gene: Jann_2360: Methyltransferase FkbM	Rhodobacterales bacterium HTCC2654	Oceanicola granulosus HTCC2516 Gene: OG2516_03685: Methyltransferase FkbM	Loktanella vestfoldensis SKA53	Oceanicola batsensis HTCC2597	Roseovarius nubinhibens ISM Gene: ISM_15995: Methyltransferase FkbM	Roseovarius sp. 217	Sulfitobacter sp. EE-36	Silicibacter TM1040 Gene: TM1040_1244: Methyltransferase FkbM	Silicibacter pomeroyi DSS-3	Roseobacter sp. MED193	Hyphomonas neptunium ATCC 15444	Oceanicaulis alexandrii HTCC2633	Methyltransferase FkbM
ISM_15990	Rhodobacter sphaeroides 2.4.1	Paracoccus denitrificans PD1222	Jannaschia sp. CCS1	Rhodobacterales bacterium HTCC2654	Oceanicola granulosus HTCC2516	Loktanella vestfoldensis SKA53	Oceanicola batsensis HTCC2597	Roseovarius nubinhibens ISM Gene: ISM_15990: hypothetical protein	Roseovarius sp. 217	Sulfitobacter sp. EE-36	Silicibacter TM1040	Silicibacter pomeroyi DSS-3	Roseobacter sp. MED193	Hyphomonas neptunium ATCC 15444	Oceanicaulis alexandrii HTCC2633	hypothetical protein
PF02475	Rhodobacter sphaeroides 2.4.1	Paracoccus denitrificans PD1222	Jannaschia sp. CCS1	Rhodobacterales bacterium HTCC2654	Oceanicola granulosus HTCC2516 Gene: OG2516_11676: Protein of unknown function Met10	Loktanella vestfoldensis SKA53	Oceanicola batsensis HTCC2597 Gene: OB2597_19321: Protein of unknown function Met10	Roseovarius nubinhibens ISM Gene: ISM_15985: Protein of unknown function Met10	2 Roseovarius sp. 217 Gene: ROS217_06585: Protein of unknown function Met10 Gene: ROS217_13371: Protein of unknown function Met10	Sulfitobacter sp. EE-36	Silicibacter TM1040	Silicibacter pomeroyi DSS-3	Roseobacter sp. MED193	Hyphomonas neptunium ATCC 15444	Oceanicaulis alexandrii HTCC2633 Gene: OA2633_06359: Protein of unknown function Met10	Protein of unknown function Met10
PDB:3cvoA	Rhodobacter sphaeroides 2.4.1	Paracoccus denitrificans PD1222	Jannaschia sp. CCS1	Rhodobacterales bacterium HTCC2654	Oceanicola granulosus HTCC2516 Gene: OG2516_03680: hypothetical protein	Loktanella vestfoldensis SKA53	2 Oceanicola batsensis HTCC2597 Gene: OB2597_03569: hypothetical protein Gene: OB2597_05505: hypothetical protein	Roseovarius nubinhibens ISM Gene: ISM_15980: hypothetical protein	Roseovarius sp. 217	Sulfitobacter sp. EE-36	Silicibacter TM1040 Gene: TM1040_0261: hypothetical protein	Silicibacter pomeroyi DSS-3 Gene: SPO2022: hypothetical protein	Roseobacter sp. MED193	Hyphomonas neptunium ATCC 15444	Oceanicaulis alexandrii HTCC2633	hypothetical protein
sufC	Rhodobacter sphaeroides 2.4.1 Gene: RSP_0437: Iron-sulfur cluster assembly ATPase protein SufC	Paracoccus denitrificans PD1222 Gene: Pden_3966: Iron-sulfur cluster assembly ATPase protein SufC	Jannaschia sp. CCS1 Gene: Jann_2359: Iron-sulfur cluster assembly ATPase protein SufC	Rhodobacterales bacterium HTCC2654 Gene: RB2654_03994: Iron-sulfur cluster assembly ATPase protein SufC	Oceanicola granulosus HTCC2516 Gene: OG2516_03675: Iron-sulfur cluster assembly ATPase protein SufC	Loktanella vestfoldensis SKA53 Gene: SKA53_05168: Iron-sulfur cluster assembly ATPase protein SufC	Oceanicola batsensis HTCC2597 Gene: OB2597_03564: Iron-sulfur cluster assembly ATPase protein SufC	Roseovarius nubinhibens ISM Gene: ISM_15975: Iron-sulfur cluster assembly ATPase protein SufC	Roseovarius sp. 217 Gene: ROS217_20517: Iron-sulfur cluster assembly ATPase protein SufC	Sulfitobacter sp. EE-36 Gene: EE36_14327: Iron-sulfur cluster assembly ATPase protein SufC	Silicibacter TM1040 Gene: TM1040_1245: Iron-sulfur cluster assembly ATPase protein SufC	Silicibacter pomeroyi DSS-3 Gene: SPO2018: Iron-sulfur cluster assembly ATPase protein SufC	Roseobacter sp. MED193 Gene: MED193_04291: Iron-sulfur cluster assembly ATPase protein SufC	Hyphomonas neptunium ATCC 15444 Gene: HNE_2616: Iron-sulfur cluster assembly ATPase protein SufC	Oceanicaulis alexandrii HTCC2633 Gene: OA2633_03226: Iron-sulfur cluster assembly ATPase protein SufC	Iron-sulfur cluster assembly ATPase protein SufC
sufD	Rhodobacter sphaeroides 2.4.1	Paracoccus denitrificans PD1222 Gene: Pden_3967: Iron-sulfur cluster assembly protein SufD	Jannaschia sp. CCS1 Gene: Jann_2358: Iron-sulfur cluster assembly protein SufD	Rhodobacterales bacterium HTCC2654 Gene: RB2654_03989: Iron-sulfur cluster assembly protein SufD	Oceanicola granulosus HTCC2516 Gene: OG2516_03670: Iron-sulfur cluster assembly protein SufD	Loktanella vestfoldensis SKA53 Gene: SKA53_05163: Iron-sulfur cluster assembly protein SufD	Oceanicola batsensis HTCC2597 Gene: OB2597_03559: Iron-sulfur cluster assembly protein SufD	Roseovarius nubinhibens ISM Gene: ISM_15970: Iron-sulfur cluster assembly protein SufD	Roseovarius sp. 217 Gene: ROS217_20512: Iron-sulfur cluster assembly protein SufD	Sulfitobacter sp. EE-36 Gene: EE36_14332: Iron-sulfur cluster assembly protein SufD	Silicibacter TM1040 Gene: TM1040_1246: Iron-sulfur cluster assembly protein SufD	Silicibacter pomeroyi DSS-3 Gene: SPO2017: Iron-sulfur cluster assembly protein SufD	Roseobacter sp. MED193 Gene: MED193_04286: Iron-sulfur cluster assembly protein SufD	Hyphomonas neptunium ATCC 15444 Gene: HNE_2615: Iron-sulfur cluster assembly protein SufD	Oceanicaulis alexandrii HTCC2633 Gene: OA2633_03221: Iron-sulfur cluster assembly protein SufD	Iron-sulfur cluster assembly protein SufD
PF04893	Rhodobacter sphaeroides 2.4.1 Gene: RSP_0433: hypothetical protein	Paracoccus denitrificans PD1222 Gene: Pden_3968: hypothetical protein	Jannaschia sp. CCS1 Gene: Jann_2357: hypothetical protein	Rhodobacterales bacterium HTCC2654 Gene: RB2654_03984: hypothetical protein	Oceanicola granulosus HTCC2516 Gene: OG2516_03665: hypothetical protein	Loktanella vestfoldensis SKA53 Gene: SKA53_05158: hypothetical protein	Oceanicola batsensis HTCC2597 Gene: OB2597_03554: hypothetical protein	Roseovarius nubinhibens ISM Gene: ISM_15965: hypothetical protein	Roseovarius sp. 217 Gene: ROS217_20507: hypothetical protein	Sulfitobacter sp. EE-36 Gene: EE36_14337: hypothetical protein	Silicibacter TM1040 Gene: TM1040_1247: hypothetical protein	Silicibacter pomeroyi DSS-3 Gene: SPO2016: hypothetical protein	Roseobacter sp. MED193 Gene: MED193_04281: hypothetical protein	Hyphomonas neptunium ATCC 15444	Oceanicaulis alexandrii HTCC2633	hypothetical protein
PF04893	Rhodobacter sphaeroides 2.4.1 Gene: RSP_0432: hypothetical protein	Paracoccus denitrificans PD1222 Gene: Pden_3969: hypothetical protein	Jannaschia sp. CCS1 Gene: Jann_2356: hypothetical protein	Rhodobacterales bacterium HTCC2654 Gene: RB2654_03979: hypothetical protein	Oceanicola granulosus HTCC2516 Gene: OG2516_03660: hypothetical protein	Loktanella vestfoldensis SKA53 Gene: SKA53_05153: hypothetical protein	Oceanicola batsensis HTCC2597 Gene: OB2597_03549: hypothetical protein	Roseovarius nubinhibens ISM Gene: ISM_15960: hypothetical protein	Roseovarius sp. 217 Gene: ROS217_20502: hypothetical protein	Sulfitobacter sp. EE-36 Gene: EE36_14342: hypothetical protein	Silicibacter TM1040 Gene: TM1040_1248: hypothetical protein	Silicibacter pomeroyi DSS-3 Gene: SPO2015: hypothetical protein	Roseobacter sp. MED193 Gene: MED193_04276: hypothetical protein	Hyphomonas neptunium ATCC 15444	Oceanicaulis alexandrii HTCC2633	hypothetical protein
sufS2	Rhodobacter sphaeroides 2.4.1 Gene: RSP_0431: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily	Paracoccus denitrificans PD1222 Gene: Pden_3970: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily	Jannaschia sp. CCS1 Gene: Jann_2355: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily	Rhodobacterales bacterium HTCC2654 Gene: RB2654_03974: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily	Oceanicola granulosus HTCC2516 Gene: OG2516_03655: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily	Loktanella vestfoldensis SKA53 Gene: SKA53_05148: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily	Oceanicola batsensis HTCC2597 Gene: OB2597_03544: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily	Roseovarius nubinhibens ISM Gene: ISM_15955: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily	Roseovarius sp. 217 Gene: ROS217_20497: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily	Sulfitobacter sp. EE-36 Gene: EE36_14347: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily	Silicibacter TM1040 Gene: TM1040_1249: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily	Silicibacter pomeroyi DSS-3 Gene: SPO2014: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily	Roseobacter sp. MED193 Gene: MED193_04271: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily	Hyphomonas neptunium ATCC 15444 Gene: HNE_2614: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily	Oceanicaulis alexandrii HTCC2633 Gene: OA2633_03216: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily	Cysteine desulfurase (EC 2.8.1.7), SufS subfamily
TIGR01444	Rhodobacter sphaeroides 2.4.1	Paracoccus denitrificans PD1222	Jannaschia sp. CCS1 Gene: Jann_2363: Methyltransferase FkbM	Rhodobacterales bacterium HTCC2654	Oceanicola granulosus HTCC2516	Loktanella vestfoldensis SKA53	Oceanicola batsensis HTCC2597	Roseovarius nubinhibens ISM	Roseovarius sp. 217	Sulfitobacter sp. EE-36	Silicibacter TM1040	Silicibacter pomeroyi DSS-3 Gene: SPO2020: Methyltransferase FkbM	Roseobacter sp. MED193	Hyphomonas neptunium ATCC 15444	Oceanicaulis alexandrii HTCC2633	Methyltransferase FkbM
PF04230	Rhodobacter sphaeroides 2.4.1	Paracoccus denitrificans PD1222	Jannaschia sp. CCS1 Gene: Jann_2361: ExoV domain protein	Rhodobacterales bacterium HTCC2654	Oceanicola granulosus HTCC2516	Loktanella vestfoldensis SKA53	Oceanicola batsensis HTCC2597	Roseovarius nubinhibens ISM	Roseovarius sp. 217	Sulfitobacter sp. EE-36 Gene: EE36_14322: ExoV domain protein	Silicibacter TM1040	Silicibacter pomeroyi DSS-3	Roseobacter sp. MED193 Gene: MED193_04296: ExoV domain protein	Hyphomonas neptunium ATCC 15444	Oceanicaulis alexandrii HTCC2633	ExoV domain protein
MED193_04306	Rhodobacter sphaeroides 2.4.1	Paracoccus denitrificans PD1222	Jannaschia sp. CCS1	Rhodobacterales bacterium HTCC2654	Oceanicola granulosus HTCC2516	Loktanella vestfoldensis SKA53	Oceanicola batsensis HTCC2597	Roseovarius nubinhibens ISM	Roseovarius sp. 217	Sulfitobacter sp. EE-36	Silicibacter TM1040	Silicibacter pomeroyi DSS-3	Roseobacter sp. MED193 Gene: MED193_04306: hypothetical protein	Hyphomonas neptunium ATCC 15444	Oceanicaulis alexandrii HTCC2633	hypothetical protein
PF01906	Rhodobacter sphaeroides 2.4.1 Gene: RSP_0439: hypothetical protein	Paracoccus denitrificans PD1222 Gene: Pden_3965: hypothetical protein	Jannaschia sp. CCS1	Rhodobacterales bacterium HTCC2654	Oceanicola granulosus HTCC2516	Loktanella vestfoldensis SKA53	Oceanicola batsensis HTCC2597 Gene: OB2597_03574: hypothetical protein	Roseovarius nubinhibens ISM	Roseovarius sp. 217 Gene: ROS217_20527: hypothetical protein	Sulfitobacter sp. EE-36	Silicibacter TM1040 Gene: TM1040_1243: hypothetical protein	Silicibacter pomeroyi DSS-3 Gene: SPO2021: hypothetical protein	Roseobacter sp. MED193 Gene: MED193_04301: hypothetical protein	Hyphomonas neptunium ATCC 15444	Oceanicaulis alexandrii HTCC2633 Gene: OA2633_00480: hypothetical protein	hypothetical protein
EE36_14317	Rhodobacter sphaeroides 2.4.1	Paracoccus denitrificans PD1222	Jannaschia sp. CCS1	Rhodobacterales bacterium HTCC2654	Oceanicola granulosus HTCC2516	Loktanella vestfoldensis SKA53	Oceanicola batsensis HTCC2597	Roseovarius nubinhibens ISM	Roseovarius sp. 217	Sulfitobacter sp. EE-36 Gene: EE36_14317: hypothetical protein	Silicibacter TM1040	Silicibacter pomeroyi DSS-3	Roseobacter sp. MED193	Hyphomonas neptunium ATCC 15444	Oceanicaulis alexandrii HTCC2633	hypothetical protein
OG2516_18780	Rhodobacter sphaeroides 2.4.1	Paracoccus denitrificans PD1222	Jannaschia sp. CCS1	Rhodobacterales bacterium HTCC2654	Oceanicola granulosus HTCC2516 Gene: OG2516_18780: probable glycosyl transferase	Loktanella vestfoldensis SKA53	Oceanicola batsensis HTCC2597	Roseovarius nubinhibens ISM Gene: ISM_03545: Probable glycosyl transferase	Roseovarius sp. 217 Gene: ROS217_20522: hypothetical protein	Sulfitobacter sp. EE-36	Silicibacter TM1040	Silicibacter pomeroyi DSS-3	Roseobacter sp. MED193	Hyphomonas neptunium ATCC 15444	Oceanicaulis alexandrii HTCC2633	probable glycosyl transferase
CRON 2.
fssA	Rhodobacter sphaeroides 2.4.1 Gene: RSP_2214: putative nifU-like iron-sulphur cluster scaffold protein	Paracoccus denitrificans PD1222 Gene: Pden_0531: putative nifU-like iron-sulphur cluster scaffold protein	* Jannaschia sp. CCS1 Site: position = -79 score = 4.85083 sequence = ACTTTAGAACGATTCCAGTTC Gene: Jann_0865: putative nifU-like iron-sulphur cluster scaffold protein	* Rhodobacterales bacterium HTCC2654 Site: position = -52 score = 4.80568 sequence = GACTTGGAACGATTCCAAGCT Gene: RB2654_18613: putative nifU-like iron-sulphur cluster scaffold protein	Oceanicola granulosus HTCC2516 Gene: OG2516_07967: putative nifU-like iron-sulphur cluster scaffold protein	* Loktanella vestfoldensis SKA53 Site: position = -78 score = 5.93031 sequence = AGTTTAGAATCGTTCCAAATC Gene: SKA53_14701: putative nifU-like iron-sulphur cluster scaffold protein	* Oceanicola batsensis HTCC2597 Site: position = -79 score = 5.2442 sequence = GAATTAGAACGGTTCTAAATC Gene: OB2597_10089: putative nifU-like iron-sulphur cluster scaffold protein	* Roseovarius nubinhibens ISM Site: position = -77 score = 5.55473 sequence = TTTTTAGAATCGTTCCAAATC Gene: ISM_02850: putative nifU-like iron-sulphur cluster scaffold protein	* Roseovarius sp. 217 Site: position = -76 score = 5.81444 sequence = ATCTTAGAATGGTTCTAAACC Gene: ROS217_10487: putative nifU-like iron-sulphur cluster scaffold protein	* Sulfitobacter sp. EE-36 Site: position = -76 score = 5.52203 sequence = AACTTAGAATCGTTCCAAACC Gene: EE36_09510: putative nifU-like iron-sulphur cluster scaffold protein	* Silicibacter TM1040 Site: position = -74 score = 5.74923 sequence = AATTTAGAACCATTCCAAAAC Gene: TM1040_3091: putative nifU-like iron-sulphur cluster scaffold protein	* Silicibacter pomeroyi DSS-3 Site: position = -76 score = 5.71341 sequence = TCTTTAGAACCGTTCCAAAGT Gene: SPO0382: putative nifU-like iron-sulphur cluster scaffold protein	* Roseobacter sp. MED193 Site: position = -75 score = 6.40217 sequence = AATTTAGAATAATTCTAAACC Gene: MED193_10358: putative nifU-like iron-sulphur cluster scaffold protein	Hyphomonas neptunium ATCC 15444 Gene: HNE_0522: putative nifU-like iron-sulphur cluster scaffold protein	Oceanicaulis alexandrii HTCC2633 Gene: OA2633_10184: putative nifU-like iron-sulphur cluster scaffold protein	putative nifU-like iron-sulphur cluster scaffold protein
CRON 3.
mbfA	* Rhodobacter sphaeroides 2.4.1 Site: position = -29 score = 5.85157 sequence = AATTTAGAATGACTCTAAAAA Gene: RSP_0850: membrane-bound ferritin	Paracoccus denitrificans PD1222	Jannaschia sp. CCS1	* Rhodobacterales bacterium HTCC2654 Site: position = -30 score = 5.96709 sequence = AGTTTGGAATCGTTCCAAACA Gene: RB2654_16991: membrane-bound ferritin	Oceanicola granulosus HTCC2516	* Loktanella vestfoldensis SKA53 Site: position = -32 score = 6.12841 sequence = AGATTAGAATCATTCTAAATA Gene: SKA53_14166: membrane-bound ferritin	Oceanicola batsensis HTCC2597	* Roseovarius nubinhibens ISM Site: position = -39 score = 5.90265 sequence = AGTTTAGAATCATTCTAATTG Gene: ISM_08740: membrane-bound ferritin	* Roseovarius sp. 217 Site: position = -30 score = 6.34018 sequence = AGTTTAGAATTATTCTAAAAG Gene: ROS217_11126: membrane-bound ferritin	Sulfitobacter sp. EE-36	Silicibacter TM1040	* Silicibacter pomeroyi DSS-3 Site: position = -32 score = 5.79759 sequence = ATCTTGGAATCATTCTAAATT Gene: SPO3842: membrane-bound ferritin	Roseobacter sp. MED193	Hyphomonas neptunium ATCC 15444	Oceanicaulis alexandrii HTCC2633	membrane-bound ferritin
CRON 4.
ccpA	* Rhodobacter sphaeroides 2.4.1 Site: position = -87 score = 4.89959 sequence = AGATTAGAATTGATCTAAGTC Gene: RSP_2395: Cytochrome c551 peroxidase (EC 1.11.1.5)	Paracoccus denitrificans PD1222 Gene: Pden_0893: Cytochrome c551 peroxidase (EC 1.11.1.5)	Jannaschia sp. CCS1	Rhodobacterales bacterium HTCC2654	Oceanicola granulosus HTCC2516	Loktanella vestfoldensis SKA53	Oceanicola batsensis HTCC2597	Roseovarius nubinhibens ISM	* Roseovarius sp. 217 Site: position = -75 score = 5.51004 sequence = GATTTAGAATGGTTCCAAACG Gene: ROS217_11501: Cytochrome c551 peroxidase (EC 1.11.1.5)	Sulfitobacter sp. EE-36	Silicibacter TM1040	* Silicibacter pomeroyi DSS-3 Site: position = -72 score = 5.26077 sequence = ATGTTAGAATGATTCTAATCG Gene: SPO0330: Cytochrome c551 peroxidase (EC 1.11.1.5)	Roseobacter sp. MED193	Hyphomonas neptunium ATCC 15444	Oceanicaulis alexandrii HTCC2633	Cytochrome c551 peroxidase (EC 1.11.1.5)
CRON 5.
irpA	Rhodobacter sphaeroides 2.4.1 Gene: RSP_1548: Iron-regulated protein A precursor	Paracoccus denitrificans PD1222	Jannaschia sp. CCS1 Gene: Jann_1368: Iron-regulated protein A precursor	* Rhodobacterales bacterium HTCC2654 Site: position = -46 score = 5.42956 sequence = TGATTGGAACCATTCCAAATT Gene: RB2654_13154: Iron-regulated protein A precursor	Oceanicola granulosus HTCC2516	Loktanella vestfoldensis SKA53	Oceanicola batsensis HTCC2597	Roseovarius nubinhibens ISM Gene: ISM_04365: Iron-regulated protein A precursor	Roseovarius sp. 217 Gene: ROS217_10107: Iron-regulated protein A precursor	Sulfitobacter sp. EE-36 Gene: EE36_02713: Iron-regulated protein A precursor	Silicibacter TM1040 Gene: TM1040_2199: Iron-regulated protein A precursor	Silicibacter pomeroyi DSS-3 Gene: SPO0086: Iron-regulated protein A precursor	Roseobacter sp. MED193 Gene: MED193_19664: Iron-regulated protein A precursor	Hyphomonas neptunium ATCC 15444	Oceanicaulis alexandrii HTCC2633	Iron-regulated protein A precursor
bfd	Rhodobacter sphaeroides 2.4.1 Gene: RSP_1547: Bacterioferritin-associated ferredoxin	Paracoccus denitrificans PD1222 Gene: Pden_0615: Bacterioferritin-associated ferredoxin	Jannaschia sp. CCS1	Rhodobacterales bacterium HTCC2654 Gene: RB2654_13144: Bacterioferritin-associated ferredoxin	Oceanicola granulosus HTCC2516	Loktanella vestfoldensis SKA53	Oceanicola batsensis HTCC2597 Gene: OB2597_06820: Bacterioferritin-associated ferredoxin	Roseovarius nubinhibens ISM Gene: ISM_00995: Bacterioferritin-associated ferredoxin	Roseovarius sp. 217	Sulfitobacter sp. EE-36	Silicibacter TM1040 Gene: TM1040_2200: Bacterioferritin-associated ferredoxin	Silicibacter pomeroyi DSS-3	Roseobacter sp. MED193 Gene: MED193_19654: Bacterioferritin-associated ferredoxin	Hyphomonas neptunium ATCC 15444 Gene: HNE_3075: Bacterioferritin-associated ferredoxin	Oceanicaulis alexandrii HTCC2633 Gene: OA2633_12430: Bacterioferritin-associated ferredoxin	Bacterioferritin-associated ferredoxin
bfr	2 Rhodobacter sphaeroides 2.4.1 Gene: RSP_3342: Bacterioferritin (cytochrome b1) Gene: RSP_1546: Bacterioferritin (cytochrome b1)	Paracoccus denitrificans PD1222 Gene: Pden_0616: Bacterioferritin (cytochrome b1)	Jannaschia sp. CCS1	Rhodobacterales bacterium HTCC2654 Gene: RB2654_13139: Bacterioferritin (cytochrome b1)	Oceanicola granulosus HTCC2516	Loktanella vestfoldensis SKA53	* Oceanicola batsensis HTCC2597 Site: position = -85 score = 6.09245 sequence = TTTTTGGAATAATTCTAAATT Gene: OB2597_06815: Bacterioferritin (cytochrome b1)	Roseovarius nubinhibens ISM Gene: ISM_00990: Bacterioferritin (cytochrome b1)	Roseovarius sp. 217	Sulfitobacter sp. EE-36	Silicibacter TM1040 Gene: TM1040_2201: Bacterioferritin (cytochrome b1)	Silicibacter pomeroyi DSS-3	Roseobacter sp. MED193 Gene: MED193_19649: Bacterioferritin (cytochrome b1)	Hyphomonas neptunium ATCC 15444 Gene: HNE_3076: Bacterioferritin (cytochrome b1)	Oceanicaulis alexandrii HTCC2633	Bacterioferritin (cytochrome b1)
CRON 6.
katG	Rhodobacter sphaeroides 2.4.1	Paracoccus denitrificans PD1222	Jannaschia sp. CCS1 Gene: Jann_1586: Catalase (EC 1.11.1.6) / Peroxidase (EC 1.11.1.7)	Rhodobacterales bacterium HTCC2654	Oceanicola granulosus HTCC2516	* Loktanella vestfoldensis SKA53 Site: position = -85 score = 4.87829 sequence = ATGTTAGAAGGATTCTAAGCG Gene: SKA53_14466: Catalase (EC 1.11.1.6) / Peroxidase (EC 1.11.1.7)	Oceanicola batsensis HTCC2597	* Roseovarius nubinhibens ISM Site: position = -92 score = 4.61939 sequence = CGCTTAGAACGATTCCAAGGC Gene: ISM_16225: Catalase (EC 1.11.1.6) / Peroxidase (EC 1.11.1.7)	Roseovarius sp. 217	* Sulfitobacter sp. EE-36 Site: position = -111 score = 4.47972 sequence = ctgTTAGAAcAATTCcAgAaa Gene: EE36_11399: Catalase (EC 1.11.1.6) / Peroxidase (EC 1.11.1.7)	* Silicibacter TM1040 Site: position = -146 score = 5.71905 sequence = AACTTAGAATAATTCTGAACT Gene: TM1040_2791: Catalase (EC 1.11.1.6) / Peroxidase (EC 1.11.1.7)	Silicibacter pomeroyi DSS-3 Gene: SPOA0061: Catalase (EC 1.11.1.6) / Peroxidase (EC 1.11.1.7)	Roseobacter sp. MED193 Gene: MED193_12153: Catalase (EC 1.11.1.6) / Peroxidase (EC 1.11.1.7)	Hyphomonas neptunium ATCC 15444	Oceanicaulis alexandrii HTCC2633	Catalase (EC 1.11.1.6) / Peroxidase (EC 1.11.1.7)
CRON 7.
dps	Rhodobacter sphaeroides 2.4.1	Paracoccus denitrificans PD1222	* Jannaschia sp. CCS1 Site: position = -123 score = 6.27915 sequence = AGTTTAGAATTATTCTAGACA Gene: Jann_3276: Non-specific DNA-binding protein Dps / Iron-binding ferritin-like antioxidant protein / Ferroxidase (EC 1.16.3.1)	Rhodobacterales bacterium HTCC2654	Oceanicola granulosus HTCC2516	Loktanella vestfoldensis SKA53 Gene: SKA53_06272: Non-specific DNA-binding protein Dps / Iron-binding ferritin-like antioxidant protein / Ferroxidase (EC 1.16.3.1)	Oceanicola batsensis HTCC2597	Roseovarius nubinhibens ISM	Roseovarius sp. 217	* Sulfitobacter sp. EE-36 Site: position = -116 score = 6.25788 sequence = AGTTTAGAATAATTCCAAAAA Gene: EE36_01790: Non-specific DNA-binding protein Dps / Iron-binding ferritin-like antioxidant protein / Ferroxidase (EC 1.16.3.1)	Silicibacter TM1040	Silicibacter pomeroyi DSS-3	Roseobacter sp. MED193	Hyphomonas neptunium ATCC 15444	Oceanicaulis alexandrii HTCC2633	Non-specific DNA-binding protein Dps / Iron-binding ferritin-like antioxidant protein / Ferroxidase (EC 1.16.3.1)

Export

	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD