Regulog Irr - Rhodobacterales
| Regulator type: | Transcription factor |
| Regulator family: | FUR |
| Regulation mode: | repressor |
| Biological process: | Iron homeostasis |
| Effector: | Heme |
| Phylum: | Proteobacteria/alpha |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By trascription factor - Irr
- By taxonomy - Rhodobacterales
- By TF family - FUR
- By effector - Heme
- By pathway - Iron homeostasis
| Genome | Genes | Operons |
|---|---|---|
| Rhodobacter sphaeroides 2.4.1 | 2 | 2 |
| Paracoccus denitrificans PD1222 | ||
| Jannaschia sp. CCS1 | 14 | 3 |
| Rhodobacterales bacterium HTCC2654 | 4 | 3 |
| Oceanicola granulosus HTCC2516 | 10 | 1 |
| Loktanella vestfoldensis SKA53 | 11 | 4 |
| Oceanicola batsensis HTCC2597 | 12 | 3 |
| Roseovarius nubinhibens ISM | 16 | 4 |
| Roseovarius sp. 217 | 13 | 4 |
| Sulfitobacter sp. EE-36 | 13 | 4 |
| Silicibacter TM1040 | 12 | 3 |
| Silicibacter pomeroyi DSS-3 | 4 | 4 |
| Roseobacter sp. MED193 | 12 | 2 |
| Hyphomonas neptunium ATCC 15444 | ||
| Oceanicaulis alexandrii HTCC2633 |
| Genes | Function | |||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||||||||
| iscR |
Gene: RSP_0443: Iron-sulfur cluster regulator IscR |
Gene: Pden_2958: Iron-sulfur cluster regulator IscR |
*
Jannaschia sp. CCS1 Site: position = -137 score = 5.18857 sequence = ACCCTAGAACGATTCCAAATT Gene: Jann_2366: Iron-sulfur cluster regulator IscR |
Gene: RB2654_04009: Iron-sulfur cluster regulator IscR |
*
Oceanicola granulosus HTCC2516 Site: position = -131 score = 6.318 sequence = TGTTTAGAAGTGTTCTAAACT Gene: OG2516_03700: Iron-sulfur cluster regulator IscR |
*
Loktanella vestfoldensis SKA53 Site: position = -111 score = 5.86635 sequence = ACCTTAGAAGGATTCTAAACT Gene: SKA53_05183: Iron-sulfur cluster regulator IscR |
*
Oceanicola batsensis HTCC2597 Site: position = -114 score = 5.03496 sequence = ACCTTAGAAAGATTCTAAAGC Gene: OB2597_03589: Iron-sulfur cluster regulator IscR |
*
Roseovarius nubinhibens ISM Site: position = -129 score = 6.34207 sequence = ACTTTAGAACTGTTCTAAACA Gene: ISM_16015: Iron-sulfur cluster regulator IscR |
*
Roseovarius sp. 217 Site: position = -100 score = 5.96286 sequence = ACCTTAGAACTGTTCTAAATT Gene: ROS217_20542: Iron-sulfur cluster regulator IscR |
*
Sulfitobacter sp. EE-36 Site: position = -116 score = 5.90335 sequence = AGTTTAGAACGGTTCTAACTT Gene: EE36_14302: Iron-sulfur cluster regulator IscR |
*
Silicibacter TM1040 Site: position = -117 score = 5.69427 sequence = ACCTTAGAACTGTTCTAAAGA Gene: TM1040_1240: Iron-sulfur cluster regulator IscR |
*
Silicibacter pomeroyi DSS-3 Site: position = -121 score = 5.24073 sequence = ATCTTAGAATGGTTCTAAGTC Gene: SPO2025: Iron-sulfur cluster regulator IscR |
*
Roseobacter sp. MED193 Site: position = -124 score = 5.31165 sequence = ATCTTAGAACAATTCTAATTG Gene: MED193_04321: Iron-sulfur cluster regulator IscR |
|
Gene: OA2633_03246: Iron-sulfur cluster regulator IscR |
Iron-sulfur cluster regulator IscR |
| sufS |
Gene: RSP_0442: Cysteine desulfurase (EC 2.8.1.7) |
Gene: Pden_3963: Cysteine desulfurase (EC 2.8.1.7) |
Gene: Jann_2365: Cysteine desulfurase (EC 2.8.1.7) |
Gene: RB2654_04004: Cysteine desulfurase (EC 2.8.1.7) |
Gene: OG2516_03695: Cysteine desulfurase (EC 2.8.1.7) |
Gene: SKA53_05178: Cysteine desulfurase (EC 2.8.1.7) |
Gene: OB2597_03584: Cysteine desulfurase (EC 2.8.1.7) |
Gene: ISM_16010: Cysteine desulfurase (EC 2.8.1.7) |
Gene: ROS217_20537: Cysteine desulfurase (EC 2.8.1.7) |
Gene: EE36_14307: Cysteine desulfurase (EC 2.8.1.7) |
Gene: TM1040_1241: Cysteine desulfurase (EC 2.8.1.7) |
|
Gene: MED193_04316: Cysteine desulfurase (EC 2.8.1.7) |
Gene: HNE_2620: Cysteine desulfurase (EC 2.8.1.7) |
Gene: OA2633_03241: Cysteine desulfurase (EC 2.8.1.7) |
Cysteine desulfurase (EC 2.8.1.7) |
| sufB |
Gene: RSP_0440: Iron-sulfur assembly protein SufB |
Gene: Pden_3964: Iron-sulfur assembly protein SufB |
Gene: Jann_2364: Iron-sulfur assembly protein SufB |
Gene: RB2654_03999: Iron-sulfur assembly protein SufB |
Gene: OG2516_03690: Iron-sulfur assembly protein SufB |
Gene: SKA53_05173: Iron-sulfur assembly protein SufB |
Gene: OB2597_03579: Iron-sulfur assembly protein SufB |
Gene: ISM_16005: Iron-sulfur assembly protein SufB |
Gene: ROS217_20532: Iron-sulfur assembly protein SufB |
Gene: EE36_14312: Iron-sulfur assembly protein SufB |
Gene: TM1040_1242: Iron-sulfur assembly protein SufB |
Gene: SPO2023: Iron-sulfur assembly protein SufB |
Gene: MED193_04311: Iron-sulfur assembly protein SufB |
Gene: HNE_2619: Iron-sulfur assembly protein SufB |
Gene: OA2633_03236: Iron-sulfur assembly protein SufB |
Iron-sulfur assembly protein SufB |
| ISM_16000 |
|
|
|
|
|
|
|
Gene: ISM_16000: hypothetical protein |
|
|
|
|
|
|
|
hypothetical protein |
| PF02475 |
|
|
2
Jannaschia sp. CCS1 Gene: Jann_2362: Methyltransferase FkbM Gene: Jann_2360: Methyltransferase FkbM |
|
Gene: OG2516_03685: Methyltransferase FkbM |
|
|
Gene: ISM_15995: Methyltransferase FkbM |
|
|
Gene: TM1040_1244: Methyltransferase FkbM |
|
|
|
|
Methyltransferase FkbM |
| ISM_15990 |
|
|
|
|
|
|
|
Gene: ISM_15990: hypothetical protein |
|
|
|
|
|
|
|
hypothetical protein |
| PF02475 |
|
|
|
|
Gene: OG2516_11676: Protein of unknown function Met10 |
|
Gene: OB2597_19321: Protein of unknown function Met10 |
Gene: ISM_15985: Protein of unknown function Met10 |
2
Roseovarius sp. 217 Gene: ROS217_06585: Protein of unknown function Met10 Gene: ROS217_13371: Protein of unknown function Met10 |
|
|
|
|
|
Gene: OA2633_06359: Protein of unknown function Met10 |
Protein of unknown function Met10 |
| PDB:3cvoA |
|
|
|
|
Gene: OG2516_03680: hypothetical protein |
|
2
Oceanicola batsensis HTCC2597 Gene: OB2597_03569: hypothetical protein Gene: OB2597_05505: hypothetical protein |
Gene: ISM_15980: hypothetical protein |
|
|
Gene: TM1040_0261: hypothetical protein |
Gene: SPO2022: hypothetical protein |
|
|
|
hypothetical protein |
| sufC |
Gene: RSP_0437: Iron-sulfur cluster assembly ATPase protein SufC |
Gene: Pden_3966: Iron-sulfur cluster assembly ATPase protein SufC |
Gene: Jann_2359: Iron-sulfur cluster assembly ATPase protein SufC |
Gene: RB2654_03994: Iron-sulfur cluster assembly ATPase protein SufC |
Gene: OG2516_03675: Iron-sulfur cluster assembly ATPase protein SufC |
Gene: SKA53_05168: Iron-sulfur cluster assembly ATPase protein SufC |
Gene: OB2597_03564: Iron-sulfur cluster assembly ATPase protein SufC |
Gene: ISM_15975: Iron-sulfur cluster assembly ATPase protein SufC |
Gene: ROS217_20517: Iron-sulfur cluster assembly ATPase protein SufC |
Gene: EE36_14327: Iron-sulfur cluster assembly ATPase protein SufC |
Gene: TM1040_1245: Iron-sulfur cluster assembly ATPase protein SufC |
Gene: SPO2018: Iron-sulfur cluster assembly ATPase protein SufC |
Gene: MED193_04291: Iron-sulfur cluster assembly ATPase protein SufC |
Gene: HNE_2616: Iron-sulfur cluster assembly ATPase protein SufC |
Gene: OA2633_03226: Iron-sulfur cluster assembly ATPase protein SufC |
Iron-sulfur cluster assembly ATPase protein SufC |
| sufD |
|
Gene: Pden_3967: Iron-sulfur cluster assembly protein SufD |
Gene: Jann_2358: Iron-sulfur cluster assembly protein SufD |
Gene: RB2654_03989: Iron-sulfur cluster assembly protein SufD |
Gene: OG2516_03670: Iron-sulfur cluster assembly protein SufD |
Gene: SKA53_05163: Iron-sulfur cluster assembly protein SufD |
Gene: OB2597_03559: Iron-sulfur cluster assembly protein SufD |
Gene: ISM_15970: Iron-sulfur cluster assembly protein SufD |
Gene: ROS217_20512: Iron-sulfur cluster assembly protein SufD |
Gene: EE36_14332: Iron-sulfur cluster assembly protein SufD |
Gene: TM1040_1246: Iron-sulfur cluster assembly protein SufD |
Gene: SPO2017: Iron-sulfur cluster assembly protein SufD |
Gene: MED193_04286: Iron-sulfur cluster assembly protein SufD |
Gene: HNE_2615: Iron-sulfur cluster assembly protein SufD |
Gene: OA2633_03221: Iron-sulfur cluster assembly protein SufD |
Iron-sulfur cluster assembly protein SufD |
| PF04893 |
Gene: RSP_0433: hypothetical protein |
Gene: Pden_3968: hypothetical protein |
Gene: Jann_2357: hypothetical protein |
Gene: RB2654_03984: hypothetical protein |
Gene: OG2516_03665: hypothetical protein |
Gene: SKA53_05158: hypothetical protein |
Gene: OB2597_03554: hypothetical protein |
Gene: ISM_15965: hypothetical protein |
Gene: ROS217_20507: hypothetical protein |
Gene: EE36_14337: hypothetical protein |
Gene: TM1040_1247: hypothetical protein |
Gene: SPO2016: hypothetical protein |
Gene: MED193_04281: hypothetical protein |
|
|
hypothetical protein |
| PF04893 |
Gene: RSP_0432: hypothetical protein |
Gene: Pden_3969: hypothetical protein |
Gene: Jann_2356: hypothetical protein |
Gene: RB2654_03979: hypothetical protein |
Gene: OG2516_03660: hypothetical protein |
Gene: SKA53_05153: hypothetical protein |
Gene: OB2597_03549: hypothetical protein |
Gene: ISM_15960: hypothetical protein |
Gene: ROS217_20502: hypothetical protein |
Gene: EE36_14342: hypothetical protein |
Gene: TM1040_1248: hypothetical protein |
Gene: SPO2015: hypothetical protein |
Gene: MED193_04276: hypothetical protein |
|
|
hypothetical protein |
| sufS2 |
Gene: RSP_0431: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily |
Gene: Pden_3970: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily |
Gene: Jann_2355: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily |
Gene: RB2654_03974: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily |
Gene: OG2516_03655: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily |
Gene: SKA53_05148: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily |
Gene: OB2597_03544: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily |
Gene: ISM_15955: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily |
Gene: ROS217_20497: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily |
Gene: EE36_14347: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily |
Gene: TM1040_1249: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily |
Gene: SPO2014: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily |
Gene: MED193_04271: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily |
Gene: HNE_2614: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily |
Gene: OA2633_03216: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily |
Cysteine desulfurase (EC 2.8.1.7), SufS subfamily |
| TIGR01444 |
|
|
Gene: Jann_2363: Methyltransferase FkbM |
|
|
|
|
|
|
|
|
Gene: SPO2020: Methyltransferase FkbM |
|
|
|
Methyltransferase FkbM |
| PF04230 |
|
|
Gene: Jann_2361: ExoV domain protein |
|
|
|
|
|
|
Gene: EE36_14322: ExoV domain protein |
|
|
Gene: MED193_04296: ExoV domain protein |
|
|
ExoV domain protein |
| MED193_04306 |
|
|
|
|
|
|
|
|
|
|
|
|
Gene: MED193_04306: hypothetical protein |
|
|
hypothetical protein |
| PF01906 |
Gene: RSP_0439: hypothetical protein |
Gene: Pden_3965: hypothetical protein |
|
|
|
|
Gene: OB2597_03574: hypothetical protein |
|
Gene: ROS217_20527: hypothetical protein |
|
Gene: TM1040_1243: hypothetical protein |
Gene: SPO2021: hypothetical protein |
Gene: MED193_04301: hypothetical protein |
|
Gene: OA2633_00480: hypothetical protein |
hypothetical protein |
| EE36_14317 |
|
|
|
|
|
|
|
|
|
Gene: EE36_14317: hypothetical protein |
|
|
|
|
|
hypothetical protein |
| OG2516_18780 |
|
|
|
|
Gene: OG2516_18780: probable glycosyl transferase |
|
|
Gene: ISM_03545: Probable glycosyl transferase |
Gene: ROS217_20522: hypothetical protein |
|
|
|
|
|
|
probable glycosyl transferase |
| CRON 2. | ||||||||||||||||
| fssA |
Gene: RSP_2214: putative nifU-like iron-sulphur cluster scaffold protein |
Gene: Pden_0531: putative nifU-like iron-sulphur cluster scaffold protein |
*
Jannaschia sp. CCS1 Site: position = -79 score = 4.85083 sequence = ACTTTAGAACGATTCCAGTTC Gene: Jann_0865: putative nifU-like iron-sulphur cluster scaffold protein |
*
Rhodobacterales bacterium HTCC2654 Site: position = -52 score = 4.80568 sequence = GACTTGGAACGATTCCAAGCT Gene: RB2654_18613: putative nifU-like iron-sulphur cluster scaffold protein |
Gene: OG2516_07967: putative nifU-like iron-sulphur cluster scaffold protein |
*
Loktanella vestfoldensis SKA53 Site: position = -78 score = 5.93031 sequence = AGTTTAGAATCGTTCCAAATC Gene: SKA53_14701: putative nifU-like iron-sulphur cluster scaffold protein |
*
Oceanicola batsensis HTCC2597 Site: position = -79 score = 5.2442 sequence = GAATTAGAACGGTTCTAAATC Gene: OB2597_10089: putative nifU-like iron-sulphur cluster scaffold protein |
*
Roseovarius nubinhibens ISM Site: position = -77 score = 5.55473 sequence = TTTTTAGAATCGTTCCAAATC Gene: ISM_02850: putative nifU-like iron-sulphur cluster scaffold protein |
*
Roseovarius sp. 217 Site: position = -76 score = 5.81444 sequence = ATCTTAGAATGGTTCTAAACC Gene: ROS217_10487: putative nifU-like iron-sulphur cluster scaffold protein |
*
Sulfitobacter sp. EE-36 Site: position = -76 score = 5.52203 sequence = AACTTAGAATCGTTCCAAACC Gene: EE36_09510: putative nifU-like iron-sulphur cluster scaffold protein |
*
Silicibacter TM1040 Site: position = -74 score = 5.74923 sequence = AATTTAGAACCATTCCAAAAC Gene: TM1040_3091: putative nifU-like iron-sulphur cluster scaffold protein |
*
Silicibacter pomeroyi DSS-3 Site: position = -76 score = 5.71341 sequence = TCTTTAGAACCGTTCCAAAGT Gene: SPO0382: putative nifU-like iron-sulphur cluster scaffold protein |
*
Roseobacter sp. MED193 Site: position = -75 score = 6.40217 sequence = AATTTAGAATAATTCTAAACC Gene: MED193_10358: putative nifU-like iron-sulphur cluster scaffold protein |
Gene: HNE_0522: putative nifU-like iron-sulphur cluster scaffold protein |
Gene: OA2633_10184: putative nifU-like iron-sulphur cluster scaffold protein |
putative nifU-like iron-sulphur cluster scaffold protein |
| CRON 3. | ||||||||||||||||
| mbfA |
*
Rhodobacter sphaeroides 2.4.1 Site: position = -29 score = 5.85157 sequence = AATTTAGAATGACTCTAAAAA Gene: RSP_0850: membrane-bound ferritin |
|
|
*
Rhodobacterales bacterium HTCC2654 Site: position = -30 score = 5.96709 sequence = AGTTTGGAATCGTTCCAAACA Gene: RB2654_16991: membrane-bound ferritin |
|
*
Loktanella vestfoldensis SKA53 Site: position = -32 score = 6.12841 sequence = AGATTAGAATCATTCTAAATA Gene: SKA53_14166: membrane-bound ferritin |
|
*
Roseovarius nubinhibens ISM Site: position = -39 score = 5.90265 sequence = AGTTTAGAATCATTCTAATTG Gene: ISM_08740: membrane-bound ferritin |
*
Roseovarius sp. 217 Site: position = -30 score = 6.34018 sequence = AGTTTAGAATTATTCTAAAAG Gene: ROS217_11126: membrane-bound ferritin |
|
|
*
Silicibacter pomeroyi DSS-3 Site: position = -32 score = 5.79759 sequence = ATCTTGGAATCATTCTAAATT Gene: SPO3842: membrane-bound ferritin |
|
|
|
membrane-bound ferritin |
| CRON 4. | ||||||||||||||||
| ccpA |
*
Rhodobacter sphaeroides 2.4.1 Site: position = -87 score = 4.89959 sequence = AGATTAGAATTGATCTAAGTC Gene: RSP_2395: Cytochrome c551 peroxidase (EC 1.11.1.5) |
Gene: Pden_0893: Cytochrome c551 peroxidase (EC 1.11.1.5) |
|
|
|
|
|
|
*
Roseovarius sp. 217 Site: position = -75 score = 5.51004 sequence = GATTTAGAATGGTTCCAAACG Gene: ROS217_11501: Cytochrome c551 peroxidase (EC 1.11.1.5) |
|
|
*
Silicibacter pomeroyi DSS-3 Site: position = -72 score = 5.26077 sequence = ATGTTAGAATGATTCTAATCG Gene: SPO0330: Cytochrome c551 peroxidase (EC 1.11.1.5) |
|
|
|
Cytochrome c551 peroxidase (EC 1.11.1.5) |
| CRON 5. | ||||||||||||||||
| irpA |
Gene: RSP_1548: Iron-regulated protein A precursor |
|
Gene: Jann_1368: Iron-regulated protein A precursor |
*
Rhodobacterales bacterium HTCC2654 Site: position = -46 score = 5.42956 sequence = TGATTGGAACCATTCCAAATT Gene: RB2654_13154: Iron-regulated protein A precursor |
|
|
|
Gene: ISM_04365: Iron-regulated protein A precursor |
Gene: ROS217_10107: Iron-regulated protein A precursor |
Gene: EE36_02713: Iron-regulated protein A precursor |
Gene: TM1040_2199: Iron-regulated protein A precursor |
Gene: SPO0086: Iron-regulated protein A precursor |
Gene: MED193_19664: Iron-regulated protein A precursor |
|
|
Iron-regulated protein A precursor |
| bfd |
Gene: RSP_1547: Bacterioferritin-associated ferredoxin |
Gene: Pden_0615: Bacterioferritin-associated ferredoxin |
|
Gene: RB2654_13144: Bacterioferritin-associated ferredoxin |
|
|
Gene: OB2597_06820: Bacterioferritin-associated ferredoxin |
Gene: ISM_00995: Bacterioferritin-associated ferredoxin |
|
|
Gene: TM1040_2200: Bacterioferritin-associated ferredoxin |
|
Gene: MED193_19654: Bacterioferritin-associated ferredoxin |
Gene: HNE_3075: Bacterioferritin-associated ferredoxin |
Gene: OA2633_12430: Bacterioferritin-associated ferredoxin |
Bacterioferritin-associated ferredoxin |
| bfr |
2
Rhodobacter sphaeroides 2.4.1 Gene: RSP_3342: Bacterioferritin (cytochrome b1) Gene: RSP_1546: Bacterioferritin (cytochrome b1) |
Gene: Pden_0616: Bacterioferritin (cytochrome b1) |
|
Gene: RB2654_13139: Bacterioferritin (cytochrome b1) |
|
|
*
Oceanicola batsensis HTCC2597 Site: position = -85 score = 6.09245 sequence = TTTTTGGAATAATTCTAAATT Gene: OB2597_06815: Bacterioferritin (cytochrome b1) |
Gene: ISM_00990: Bacterioferritin (cytochrome b1) |
|
|
Gene: TM1040_2201: Bacterioferritin (cytochrome b1) |
|
Gene: MED193_19649: Bacterioferritin (cytochrome b1) |
Gene: HNE_3076: Bacterioferritin (cytochrome b1) |
|
Bacterioferritin (cytochrome b1) |
| CRON 6. | ||||||||||||||||
| katG |
|
|
Gene: Jann_1586: Catalase (EC 1.11.1.6) / Peroxidase (EC 1.11.1.7) |
|
|
*
Loktanella vestfoldensis SKA53 Site: position = -85 score = 4.87829 sequence = ATGTTAGAAGGATTCTAAGCG Gene: SKA53_14466: Catalase (EC 1.11.1.6) / Peroxidase (EC 1.11.1.7) |
|
*
Roseovarius nubinhibens ISM Site: position = -92 score = 4.61939 sequence = CGCTTAGAACGATTCCAAGGC Gene: ISM_16225: Catalase (EC 1.11.1.6) / Peroxidase (EC 1.11.1.7) |
|
*
Sulfitobacter sp. EE-36 Site: position = -111 score = 4.47972 sequence = ctgTTAGAAcAATTCcAgAaa Gene: EE36_11399: Catalase (EC 1.11.1.6) / Peroxidase (EC 1.11.1.7) |
*
Silicibacter TM1040 Site: position = -146 score = 5.71905 sequence = AACTTAGAATAATTCTGAACT Gene: TM1040_2791: Catalase (EC 1.11.1.6) / Peroxidase (EC 1.11.1.7) |
Gene: SPOA0061: Catalase (EC 1.11.1.6) / Peroxidase (EC 1.11.1.7) |
Gene: MED193_12153: Catalase (EC 1.11.1.6) / Peroxidase (EC 1.11.1.7) |
|
|
Catalase (EC 1.11.1.6) / Peroxidase (EC 1.11.1.7) |
| CRON 7. | ||||||||||||||||
| dps |
|
|
*
Jannaschia sp. CCS1 Site: position = -123 score = 6.27915 sequence = AGTTTAGAATTATTCTAGACA Gene: Jann_3276: Non-specific DNA-binding protein Dps / Iron-binding ferritin-like antioxidant protein / Ferroxidase (EC 1.16.3.1) |
|
|
Gene: SKA53_06272: Non-specific DNA-binding protein Dps / Iron-binding ferritin-like antioxidant protein / Ferroxidase (EC 1.16.3.1) |
|
|
|
*
Sulfitobacter sp. EE-36 Site: position = -116 score = 6.25788 sequence = AGTTTAGAATAATTCCAAAAA Gene: EE36_01790: Non-specific DNA-binding protein Dps / Iron-binding ferritin-like antioxidant protein / Ferroxidase (EC 1.16.3.1) |
|
|
|
|
|
Non-specific DNA-binding protein Dps / Iron-binding ferritin-like antioxidant protein / Ferroxidase (EC 1.16.3.1) |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |