Regulon of Irr in Jannaschia sp. CCS1

Properties
Regulator type:	Transcription factor
TF locus tag:	Jann_1652
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Iron homeostasis
Effector:	Heme
Regulog:	Irr - Rhodobacterales
Statistics of regulated genes:
- Genes	14
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 37 sites [see more]

Member of regulog collections

By trascription factor - Irr
By taxonomy - Rhodobacterales
By TF family - FUR
By effector - Heme
By pathway - Iron homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -137 Score: 5.2 Sequence: ACCCTAGAACGATTCCAAATT Locus tag: Jann_2366 Name: iscR Funciton: Iron-sulfur cluster regulator IscR Locus tag: Jann_2365 Name: sufS Funciton: Cysteine desulfurase (EC 2.8.1.7) Locus tag: Jann_2364 Name: sufB Funciton: Iron-sulfur assembly protein SufB Locus tag: Jann_2363 Name: TIGR01444 Funciton: Methyltransferase FkbM Locus tag: Jann_2362 Name: PF02475 Funciton: Methyltransferase FkbM Locus tag: Jann_2361 Name: PF04230 Funciton: ExoV domain protein Locus tag: Jann_2360 Name: PF02475 Funciton: Methyltransferase FkbM Locus tag: Jann_2359 Name: sufC Funciton: Iron-sulfur cluster assembly ATPase protein SufC Locus tag: Jann_2358 Name: sufD Funciton: Iron-sulfur cluster assembly protein SufD Locus tag: Jann_2357 Name: PF04893 Funciton: hypothetical protein Locus tag: Jann_2356 Name: PF04893 Funciton: hypothetical protein Locus tag: Jann_2355 Name: sufS2 Funciton: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily
	Jann_2366	iscR	Iron-sulfur cluster regulator IscR
	Jann_2365	sufS	Cysteine desulfurase (EC 2.8.1.7)
	Jann_2364	sufB	Iron-sulfur assembly protein SufB
	Jann_2363	TIGR01444	Methyltransferase FkbM
	Jann_2362	PF02475	Methyltransferase FkbM
	Jann_2361	PF04230	ExoV domain protein
	Jann_2360	PF02475	Methyltransferase FkbM
	Jann_2359	sufC	Iron-sulfur cluster assembly ATPase protein SufC
	Jann_2358	sufD	Iron-sulfur cluster assembly protein SufD
	Jann_2357	PF04893	hypothetical protein
	Jann_2356	PF04893	hypothetical protein
	Jann_2355	sufS2	Cysteine desulfurase (EC 2.8.1.7), SufS subfamily
Position: -79 Score: 4.9 Sequence: ACTTTAGAACGATTCCAGTTC Locus tag: Jann_0865 Name: fssA Funciton: putative nifU-like iron-sulphur cluster scaffold protein
	Jann_0865	fssA	putative nifU-like iron-sulphur cluster scaffold protein
Position: -123 Score: 6.3 Sequence: AGTTTAGAATTATTCTAGACA Locus tag: Jann_3276 Name: dps Funciton: Non-specific DNA-binding protein Dps / Iron-binding ferritin-like antioxidant protein / Ferroxidase (EC 1.16.3.1)
	Jann_3276	dps	Non-specific DNA-binding protein Dps / Iron-binding ferritin-like antioxidant protein / Ferroxidase (EC 1.16.3.1)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD