Regulon of Irr in Roseobacter sp. MED193

Properties
Regulator type:	Transcription factor
TF locus tag:	MED193_17849
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Iron homeostasis
Effector:	Heme
Regulog:	Irr - Rhodobacterales
Statistics of regulated genes:
- Genes	12
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 37 sites [see more]

Member of regulog collections

By trascription factor - Irr
By taxonomy - Rhodobacterales
By TF family - FUR
By effector - Heme
By pathway - Iron homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -124 Score: 5.3 Sequence: ATCTTAGAACAATTCTAATTG Locus tag: MED193_04321 Name: iscR Funciton: Iron-sulfur cluster regulator IscR Locus tag: MED193_04316 Name: sufS Funciton: Cysteine desulfurase (EC 2.8.1.7) Locus tag: MED193_04311 Name: sufB Funciton: Iron-sulfur assembly protein SufB Locus tag: MED193_04306 Name: null Funciton: hypothetical protein Locus tag: MED193_04301 Name: PF01906 Funciton: hypothetical protein Locus tag: MED193_04296 Name: PF04230 Funciton: ExoV domain protein Locus tag: MED193_04291 Name: sufC Funciton: Iron-sulfur cluster assembly ATPase protein SufC Locus tag: MED193_04286 Name: sufD Funciton: Iron-sulfur cluster assembly protein SufD Locus tag: MED193_04281 Name: PF04893 Funciton: hypothetical protein Locus tag: MED193_04276 Name: PF04893 Funciton: hypothetical protein Locus tag: MED193_04271 Name: sufS2 Funciton: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily
	MED193_04321	iscR	Iron-sulfur cluster regulator IscR
	MED193_04316	sufS	Cysteine desulfurase (EC 2.8.1.7)
	MED193_04311	sufB	Iron-sulfur assembly protein SufB
	MED193_04306		hypothetical protein
	MED193_04301	PF01906	hypothetical protein
	MED193_04296	PF04230	ExoV domain protein
	MED193_04291	sufC	Iron-sulfur cluster assembly ATPase protein SufC
	MED193_04286	sufD	Iron-sulfur cluster assembly protein SufD
	MED193_04281	PF04893	hypothetical protein
	MED193_04276	PF04893	hypothetical protein
	MED193_04271	sufS2	Cysteine desulfurase (EC 2.8.1.7), SufS subfamily
Position: -75 Score: 6.4 Sequence: AATTTAGAATAATTCTAAACC Locus tag: MED193_10358 Name: fssA Funciton: putative nifU-like iron-sulphur cluster scaffold protein
	MED193_10358	fssA	putative nifU-like iron-sulphur cluster scaffold protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD