Regulon of Irr in Rhodobacter sphaeroides 2.4.1

Properties
Regulator type:	Transcription factor
TF locus tag:	RSP_3179
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Iron homeostasis
Effector:	Heme
Regulog:	Irr - Rhodobacterales
Statistics of regulated genes:
- Genes	2
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 37 sites [see more]

Member of regulog collections

By trascription factor - Irr
By taxonomy - Rhodobacterales
By TF family - FUR
By effector - Heme
By pathway - Iron homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -29 Score: 5.9 Sequence: AATTTAGAATGACTCTAAAAA Locus tag: RSP_0850 Name: mbfA Funciton: membrane-bound ferritin
	RSP_0850	mbfA	membrane-bound ferritin
Position: -87 Score: 4.9 Sequence: AGATTAGAATTGATCTAAGTC Locus tag: RSP_2395 Name: ccpA Funciton: Cytochrome c551 peroxidase (EC 1.11.1.5)
	RSP_2395	ccpA	Cytochrome c551 peroxidase (EC 1.11.1.5)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD