Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing sufB gene

Properties
Regulog: Irr - Rhodobacterales
Regulator type: Transcription factor
Regulator family: FUR
Regulation mode: repressor
Biological process: Iron homeostasis
Effector: Heme
Phylum: Proteobacteria/alpha
Built upon 37 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Jannaschia sp. CCS1
Position: -137
Score: 5.18857
Sequence: ACCCTAGAACGATTCCAAATT
Locus tag: Jann_2366
Name: iscR
Funciton: Iron-sulfur cluster regulator IscR
Locus tag: Jann_2365
Name: sufS
Funciton: Cysteine desulfurase (EC 2.8.1.7)
Locus tag: Jann_2364
Name: sufB
Funciton: Iron-sulfur assembly protein SufB
Locus tag: Jann_2363
Name: TIGR01444
Funciton: Methyltransferase FkbM
Locus tag: Jann_2362
Name: PF02475
Funciton: Methyltransferase FkbM
Locus tag: Jann_2361
Name: PF04230
Funciton: ExoV domain protein
Locus tag: Jann_2360
Name: PF02475
Funciton: Methyltransferase FkbM
Locus tag: Jann_2359
Name: sufC
Funciton: Iron-sulfur cluster assembly ATPase protein SufC
Locus tag: Jann_2358
Name: sufD
Funciton: Iron-sulfur cluster assembly protein SufD
Locus tag: Jann_2357
Name: PF04893
Funciton: hypothetical protein
Locus tag: Jann_2356
Name: PF04893
Funciton: hypothetical protein
Locus tag: Jann_2355
Name: sufS2
Funciton: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily
iscR-sufS-sufB-TIGR01444-PF02475-PF04230-PF02475-sufC-sufD-PF04893-PF04893-sufS2 -137 5.2 ACCCTAGAACGATTCCAAATT Jann_2366
Loktanella vestfoldensis SKA53
Position: -111
Score: 5.86635
Sequence: ACCTTAGAAGGATTCTAAACT
Locus tag: SKA53_05183
Name: iscR
Funciton: Iron-sulfur cluster regulator IscR
Locus tag: SKA53_05178
Name: sufS
Funciton: Cysteine desulfurase (EC 2.8.1.7)
Locus tag: SKA53_05173
Name: sufB
Funciton: Iron-sulfur assembly protein SufB
Locus tag: SKA53_05168
Name: sufC
Funciton: Iron-sulfur cluster assembly ATPase protein SufC
Locus tag: SKA53_05163
Name: sufD
Funciton: Iron-sulfur cluster assembly protein SufD
Locus tag: SKA53_05158
Name: PF04893
Funciton: hypothetical protein
Locus tag: SKA53_05153
Name: PF04893
Funciton: hypothetical protein
Locus tag: SKA53_05148
Name: sufS2
Funciton: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily
iscR-sufS-sufB-sufC-sufD-PF04893-PF04893-sufS2 -111 5.9 ACCTTAGAAGGATTCTAAACT SKA53_05183
Oceanicola batsensis HTCC2597
Position: -114
Score: 5.03496
Sequence: ACCTTAGAAAGATTCTAAAGC
Locus tag: OB2597_03589
Name: iscR
Funciton: Iron-sulfur cluster regulator IscR
Locus tag: OB2597_03584
Name: sufS
Funciton: Cysteine desulfurase (EC 2.8.1.7)
Locus tag: OB2597_03579
Name: sufB
Funciton: Iron-sulfur assembly protein SufB
Locus tag: OB2597_03574
Name: PF01906
Funciton: hypothetical protein
Locus tag: OB2597_03569
Name: PDB:3cvoA
Funciton: hypothetical protein
Locus tag: OB2597_03564
Name: sufC
Funciton: Iron-sulfur cluster assembly ATPase protein SufC
Locus tag: OB2597_03559
Name: sufD
Funciton: Iron-sulfur cluster assembly protein SufD
Locus tag: OB2597_03554
Name: PF04893
Funciton: hypothetical protein
Locus tag: OB2597_03549
Name: PF04893
Funciton: hypothetical protein
Locus tag: OB2597_03544
Name: sufS2
Funciton: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily
iscR-sufS-sufB-PF01906-PDB:3cvoA-sufC-sufD-PF04893-PF04893-sufS2 -114 5 ACCTTAGAAAGATTCTAAAGC OB2597_03589
Oceanicola granulosus HTCC2516
Position: -131
Score: 6.318
Sequence: TGTTTAGAAGTGTTCTAAACT
Locus tag: OG2516_03700
Name: iscR
Funciton: Iron-sulfur cluster regulator IscR
Locus tag: OG2516_03695
Name: sufS
Funciton: Cysteine desulfurase (EC 2.8.1.7)
Locus tag: OG2516_03690
Name: sufB
Funciton: Iron-sulfur assembly protein SufB
Locus tag: OG2516_03685
Name: PF02475
Funciton: Methyltransferase FkbM
Locus tag: OG2516_03680
Name: PDB:3cvoA
Funciton: hypothetical protein
Locus tag: OG2516_03675
Name: sufC
Funciton: Iron-sulfur cluster assembly ATPase protein SufC
Locus tag: OG2516_03670
Name: sufD
Funciton: Iron-sulfur cluster assembly protein SufD
Locus tag: OG2516_03665
Name: PF04893
Funciton: hypothetical protein
Locus tag: OG2516_03660
Name: PF04893
Funciton: hypothetical protein
Locus tag: OG2516_03655
Name: sufS2
Funciton: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily
iscR-sufS-sufB-PF02475-PDB:3cvoA-sufC-sufD-PF04893-PF04893-sufS2 -131 6.3 TGTTTAGAAGTGTTCTAAACT OG2516_03700
Roseobacter sp. MED193
Position: -124
Score: 5.31165
Sequence: ATCTTAGAACAATTCTAATTG
Locus tag: MED193_04321
Name: iscR
Funciton: Iron-sulfur cluster regulator IscR
Locus tag: MED193_04316
Name: sufS
Funciton: Cysteine desulfurase (EC 2.8.1.7)
Locus tag: MED193_04311
Name: sufB
Funciton: Iron-sulfur assembly protein SufB
Locus tag: MED193_04306
Name: null
Funciton: hypothetical protein
Locus tag: MED193_04301
Name: PF01906
Funciton: hypothetical protein
Locus tag: MED193_04296
Name: PF04230
Funciton: ExoV domain protein
Locus tag: MED193_04291
Name: sufC
Funciton: Iron-sulfur cluster assembly ATPase protein SufC
Locus tag: MED193_04286
Name: sufD
Funciton: Iron-sulfur cluster assembly protein SufD
Locus tag: MED193_04281
Name: PF04893
Funciton: hypothetical protein
Locus tag: MED193_04276
Name: PF04893
Funciton: hypothetical protein
Locus tag: MED193_04271
Name: sufS2
Funciton: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily
iscR-sufS-sufB-MED193_04306-PF01906-PF04230-sufC-sufD-PF04893-PF04893-sufS2 -124 5.3 ATCTTAGAACAATTCTAATTG MED193_04321
Roseovarius nubinhibens ISM
Position: -129
Score: 6.34207
Sequence: ACTTTAGAACTGTTCTAAACA
Locus tag: ISM_16015
Name: iscR
Funciton: Iron-sulfur cluster regulator IscR
Locus tag: ISM_16010
Name: sufS
Funciton: Cysteine desulfurase (EC 2.8.1.7)
Locus tag: ISM_16005
Name: sufB
Funciton: Iron-sulfur assembly protein SufB
Locus tag: ISM_16000
Name: null
Funciton: hypothetical protein
Locus tag: ISM_15995
Name: PF02475
Funciton: Methyltransferase FkbM
Locus tag: ISM_15990
Name: null
Funciton: hypothetical protein
Locus tag: ISM_15985
Name: PF02475
Funciton: Protein of unknown function Met10
Locus tag: ISM_15980
Name: PDB:3cvoA
Funciton: hypothetical protein
Locus tag: ISM_15975
Name: sufC
Funciton: Iron-sulfur cluster assembly ATPase protein SufC
Locus tag: ISM_15970
Name: sufD
Funciton: Iron-sulfur cluster assembly protein SufD
Locus tag: ISM_15965
Name: PF04893
Funciton: hypothetical protein
Locus tag: ISM_15960
Name: PF04893
Funciton: hypothetical protein
Locus tag: ISM_15955
Name: sufS2
Funciton: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily
iscR-sufS-sufB-ISM_16000-PF02475-ISM_15990-PF02475-PDB:3cvoA-sufC-sufD-PF04893-PF04893-sufS2 -129 6.3 ACTTTAGAACTGTTCTAAACA ISM_16015
Roseovarius sp. 217
Position: -100
Score: 5.96286
Sequence: ACCTTAGAACTGTTCTAAATT
Locus tag: ROS217_20542
Name: iscR
Funciton: Iron-sulfur cluster regulator IscR
Locus tag: ROS217_20537
Name: sufS
Funciton: Cysteine desulfurase (EC 2.8.1.7)
Locus tag: ROS217_20532
Name: sufB
Funciton: Iron-sulfur assembly protein SufB
Locus tag: ROS217_20527
Name: PF01906
Funciton: hypothetical protein
Locus tag: ROS217_20522
Name: null
Funciton: hypothetical protein
Locus tag: ROS217_20517
Name: sufC
Funciton: Iron-sulfur cluster assembly ATPase protein SufC
Locus tag: ROS217_20512
Name: sufD
Funciton: Iron-sulfur cluster assembly protein SufD
Locus tag: ROS217_20507
Name: PF04893
Funciton: hypothetical protein
Locus tag: ROS217_20502
Name: PF04893
Funciton: hypothetical protein
Locus tag: ROS217_20497
Name: sufS2
Funciton: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily
iscR-sufS-sufB-PF01906-ROS217_20522-sufC-sufD-PF04893-PF04893-sufS2 -100 6 ACCTTAGAACTGTTCTAAATT ROS217_20542
Silicibacter TM1040
Position: -117
Score: 5.69427
Sequence: ACCTTAGAACTGTTCTAAAGA
Locus tag: TM1040_1240
Name: iscR
Funciton: Iron-sulfur cluster regulator IscR
Locus tag: TM1040_1241
Name: sufS
Funciton: Cysteine desulfurase (EC 2.8.1.7)
Locus tag: TM1040_1242
Name: sufB
Funciton: Iron-sulfur assembly protein SufB
Locus tag: TM1040_1243
Name: PF01906
Funciton: hypothetical protein
Locus tag: TM1040_1244
Name: PF02475
Funciton: Methyltransferase FkbM
Locus tag: TM1040_1245
Name: sufC
Funciton: Iron-sulfur cluster assembly ATPase protein SufC
Locus tag: TM1040_1246
Name: sufD
Funciton: Iron-sulfur cluster assembly protein SufD
Locus tag: TM1040_1247
Name: PF04893
Funciton: hypothetical protein
Locus tag: TM1040_1248
Name: PF04893
Funciton: hypothetical protein
Locus tag: TM1040_1249
Name: sufS2
Funciton: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily
iscR-sufS-sufB-PF01906-PF02475-sufC-sufD-PF04893-PF04893-sufS2 -117 5.7 ACCTTAGAACTGTTCTAAAGA TM1040_1240
Sulfitobacter sp. EE-36
Position: -116
Score: 5.90335
Sequence: AGTTTAGAACGGTTCTAACTT
Locus tag: EE36_14302
Name: iscR
Funciton: Iron-sulfur cluster regulator IscR
Locus tag: EE36_14307
Name: sufS
Funciton: Cysteine desulfurase (EC 2.8.1.7)
Locus tag: EE36_14312
Name: sufB
Funciton: Iron-sulfur assembly protein SufB
Locus tag: EE36_14317
Name: null
Funciton: hypothetical protein
Locus tag: EE36_14322
Name: PF04230
Funciton: ExoV domain protein
Locus tag: EE36_14327
Name: sufC
Funciton: Iron-sulfur cluster assembly ATPase protein SufC
Locus tag: EE36_14332
Name: sufD
Funciton: Iron-sulfur cluster assembly protein SufD
Locus tag: EE36_14337
Name: PF04893
Funciton: hypothetical protein
Locus tag: EE36_14342
Name: PF04893
Funciton: hypothetical protein
Locus tag: EE36_14347
Name: sufS2
Funciton: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily
iscR-sufS-sufB-EE36_14317-PF04230-sufC-sufD-PF04893-PF04893-sufS2 -116 5.9 AGTTTAGAACGGTTCTAACTT EE36_14302