Regulon of Irr in Rhodobacterales bacterium HTCC2654

Properties
Regulator type:	Transcription factor
TF locus tag:	RB2654_18263
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Iron homeostasis
Effector:	Heme
Regulog:	Irr - Rhodobacterales
Statistics of regulated genes:
- Genes	4
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 37 sites [see more]

Member of regulog collections

By trascription factor - Irr
By taxonomy - Rhodobacterales
By TF family - FUR
By effector - Heme
By pathway - Iron homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -52 Score: 4.8 Sequence: GACTTGGAACGATTCCAAGCT Locus tag: RB2654_18613 Name: fssA Funciton: putative nifU-like iron-sulphur cluster scaffold protein
	RB2654_18613	fssA	putative nifU-like iron-sulphur cluster scaffold protein
Position: -46 Score: 5.4 Sequence: TGATTGGAACCATTCCAAATT Locus tag: RB2654_13154 Name: irpA Funciton: Iron-regulated protein A precursor Locus tag: RB2654_13144 Name: bfd Funciton: Bacterioferritin-associated ferredoxin
	RB2654_13154	irpA	Iron-regulated protein A precursor
	RB2654_13144	bfd	Bacterioferritin-associated ferredoxin
Position: -30 Score: 6 Sequence: AGTTTGGAATCGTTCCAAACA Locus tag: RB2654_16991 Name: mbfA Funciton: membrane-bound ferritin
	RB2654_16991	mbfA	membrane-bound ferritin

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD