Regulon of Irr in Oceanicola granulosus HTCC2516

Properties
Regulator type:	Transcription factor
TF locus tag:	OG2516_14758
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Iron homeostasis
Effector:	Heme
Regulog:	Irr - Rhodobacterales
Statistics of regulated genes:
- Genes	10
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 37 sites [see more]

Member of regulog collections

By trascription factor - Irr
By taxonomy - Rhodobacterales
By TF family - FUR
By effector - Heme
By pathway - Iron homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -131 Score: 6.3 Sequence: TGTTTAGAAGTGTTCTAAACT Locus tag: OG2516_03700 Name: iscR Funciton: Iron-sulfur cluster regulator IscR Locus tag: OG2516_03695 Name: sufS Funciton: Cysteine desulfurase (EC 2.8.1.7) Locus tag: OG2516_03690 Name: sufB Funciton: Iron-sulfur assembly protein SufB Locus tag: OG2516_03685 Name: PF02475 Funciton: Methyltransferase FkbM Locus tag: OG2516_03680 Name: PDB:3cvoA Funciton: hypothetical protein Locus tag: OG2516_03675 Name: sufC Funciton: Iron-sulfur cluster assembly ATPase protein SufC Locus tag: OG2516_03670 Name: sufD Funciton: Iron-sulfur cluster assembly protein SufD Locus tag: OG2516_03665 Name: PF04893 Funciton: hypothetical protein Locus tag: OG2516_03660 Name: PF04893 Funciton: hypothetical protein Locus tag: OG2516_03655 Name: sufS2 Funciton: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily
	OG2516_03700	iscR	Iron-sulfur cluster regulator IscR
	OG2516_03695	sufS	Cysteine desulfurase (EC 2.8.1.7)
	OG2516_03690	sufB	Iron-sulfur assembly protein SufB
	OG2516_03685	PF02475	Methyltransferase FkbM
	OG2516_03680	PDB:3cvoA	hypothetical protein
	OG2516_03675	sufC	Iron-sulfur cluster assembly ATPase protein SufC
	OG2516_03670	sufD	Iron-sulfur cluster assembly protein SufD
	OG2516_03665	PF04893	hypothetical protein
	OG2516_03660	PF04893	hypothetical protein
	OG2516_03655	sufS2	Cysteine desulfurase (EC 2.8.1.7), SufS subfamily

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD