Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing irpA gene

Properties
Regulog: Irr - Rhodobacterales
Regulator type: Transcription factor
Regulator family: FUR
Regulation mode: repressor
Biological process: Iron homeostasis
Effector: Heme
Phylum: Proteobacteria/alpha
Built upon 37 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Rhodobacterales bacterium HTCC2654
Position: -46
Score: 5.42956
Sequence: TGATTGGAACCATTCCAAATT
Locus tag: RB2654_13154
Name: irpA
Funciton: Iron-regulated protein A precursor
Locus tag: RB2654_13144
Name: bfd
Funciton: Bacterioferritin-associated ferredoxin
irpA-bfd -46 5.4 TGATTGGAACCATTCCAAATT RB2654_13154