Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing bfr gene

Properties
Regulog: Irr - Rhodobacterales
Regulator type: Transcription factor
Regulator family: FUR
Regulation mode: repressor
Biological process: Iron homeostasis
Effector: Heme
Phylum: Proteobacteria/alpha
Built upon 37 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Oceanicola batsensis HTCC2597
Position: -85
Score: 6.09245
Sequence: TTTTTGGAATAATTCTAAATT
Locus tag: OB2597_06815
Name: bfr
Funciton: Bacterioferritin (cytochrome b1)
bfr -85 6.1 TTTTTGGAATAATTCTAAATT OB2597_06815