Regulog Zur - Rhizobiales

Member of regulog collections
- By taxonomy - Rhizobiales
- By trascription factor - Zur
- By TF family - FUR
- By effector - Zinc ion, (Zn2+)
- By pathway - Zinc homeostasis
Genome | Genes | Operons |
---|---|---|
Sinorhizobium meliloti 1021 | 5 | 3 |
Rhizobium sp. NGR234 | 4 | 2 |
Rhizobium leguminosarum bv. viciae 3841 | 10 | 5 |
Rhizobium etli CFN 42 | 11 | 6 |
Agrobacterium tumefaciens str. C58 (Cereon) | 10 | 6 |
Mesorhizobium sp. BNC1 | 4 | 2 |
Mesorhizobium loti MAFF303099 | 3 | 1 |
Brucella melitensis 16M | 5 | 2 |
Bartonella quintana str. Toulouse | 3 | 1 |
Rhodopseudomonas palustris CGA009 | 8 | 3 |
Bradyrhizobium japonicum USDA 110 | 7 | 2 |
Bradyrhizobium sp. BTAi1 | 9 | 4 |
Nitrobacter winogradskyi Nb-255 | 7 | 2 |
Azorhizobium caulinodans ORS 571 | ||
Xanthobacter autotrophicus Py2 |
Genes | Function | |||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
CRON 1. | ||||||||||||||||
PF11162 |
|
|
|
|
|
|
|
|
|
*
Rhodopseudomonas palustris CGA009 Site: position = -44 score = 5.2023 sequence = GCAATGTTACTTTATAACATCGG Gene: RPA4384: Conserved hypothetical protein |
*
Bradyrhizobium japonicum USDA 110 Site: position = -3 score = 5.32466 sequence = GCGATGTTACATTATAACATCGC Gene: bll2461: Conserved hypothetical protein |
*
Bradyrhizobium sp. BTAi1 Site: position = -75 score = 4.57107 sequence = GCGATGTTACTTTGTAACAATGG Gene: BBta_2267: Conserved hypothetical protein |
*
Nitrobacter winogradskyi Nb-255 Site: position = -65 score = 5.26124 sequence = CAGGCGTTATATTATAACATCCG Gene: Nwi_2630: Conserved hypothetical protein |
|
|
Conserved hypothetical protein |
omr |
|
|
|
|
|
|
|
|
|
Gene: RPA4385: Predicted zinc-regulated TonB-dependent outer membrane transporter |
Gene: bll2460: Predicted zinc-regulated TonB-dependent outer membrane transporter |
Gene: BBta_2266: Predicted zinc-regulated TonB-dependent outer membrane transporter |
Gene: Nwi_2631: Predicted zinc-regulated TonB-dependent outer membrane transporter |
|
|
Predicted zinc-regulated TonB-dependent outer membrane transporter |
CRON 2. | ||||||||||||||||
zinT |
|
|
|
*
Rhizobium etli CFN 42 Site: position = -74 score = 5.35849 sequence = GTAATGTTATTACATTACGGACT Gene: RHE_PF00158: Candidate zinc-binding lipoprotein ZinT |
*
Agrobacterium tumefaciens str. C58 (Cereon) Site: position = -58 score = 6.11983 sequence = GAAATGTAATGTTATTACGTTAC Gene: Atu1049: Candidate zinc-binding lipoprotein ZinT |
|
|
|
|
|
|
|
|
|
|
Candidate zinc-binding lipoprotein ZinT |
CRON 3. | ||||||||||||||||
znuA2 |
*
Sinorhizobium meliloti 1021 Site: position = -86 score = 5.50665 sequence = TTGATGTAATAACATAACAACGC Gene: SMc04245: Zinc ABC transporter, periplasmic-binding protein ZnuA |
*
Rhizobium sp. NGR234 Site: position = -204 score = 5.40185 sequence = TTGATGTAATAACATTACGTGCA Gene: NGR_c17650: Zinc ABC transporter, periplasmic-binding protein ZnuA |
*
Rhizobium leguminosarum bv. viciae 3841 Site: position = -89 score = 5.65781 sequence = TTGATGTAATAACATAACAATTG Gene: RL3178: Zinc ABC transporter, periplasmic-binding protein ZnuA |
*
Rhizobium etli CFN 42 Site: position = -43 score = 5.46844 sequence = TCAATGTAATAACATAACACTCG Gene: RHE_CH02712: Zinc ABC transporter, periplasmic-binding protein ZnuA |
*
Agrobacterium tumefaciens str. C58 (Cereon) Site: position = -45 score = 5.63137 sequence = TAAATGTAATAACATAACTATAC Gene: Atu1521: Zinc ABC transporter, periplasmic-binding protein ZnuA |
*
Mesorhizobium sp. BNC1 Site: position = -105 score = 5.62429 sequence = CAAGTGTAATGTCATAACGTTTA Gene: Meso_4006: Zinc ABC transporter, periplasmic-binding protein ZnuA |
|
*
Brucella melitensis 16M Site: position = -106 score = 5.26909 sequence = CAGACGTTATAGCATAACGTAAT Gene: BMEII0178: Zinc ABC transporter, periplasmic-binding protein ZnuA |
|
|
|
|
|
|
|
Zinc ABC transporter, periplasmic-binding protein ZnuA |
yciC2 |
|
|
*
Rhizobium leguminosarum bv. viciae 3841 Site: position = -44 score = 6.20834 sequence = CAAATGTAATGATATAACATAAA Gene: RL3179: Putative Putative zinc chaperone, COG0523 family |
*
Rhizobium etli CFN 42 Site: position = -39 score = 6.00065 sequence = GACATGTAATGATATAACATTAA Gene: RHE_CH02713: Putative Putative zinc chaperone, COG0523 family |
*
Agrobacterium tumefaciens str. C58 (Cereon) Site: position = -120 score = 5.90585 sequence = CATATGTAATGTTATTACGTTAC Site: position = -262 score = 5.88427 sequence = GATATGTAATGTTATTACATTCG Gene: Atu3181: Putative Putative zinc chaperone, COG0523 family |
|
|
Gene: BMEII0179: Putative Putative zinc chaperone, COG0523 family |
|
*
Rhodopseudomonas palustris CGA009 Site: position = -65 score = 5.82893 sequence = TTTATGTAATGTTATAACGTTTC Gene: RPA1462: Putative Putative zinc chaperone, COG0523 family |
|
|
|
|
|
Putative Putative zinc chaperone, COG0523 family |
CRON 4. | ||||||||||||||||
znuC2 |
*
Sinorhizobium meliloti 1021 Site: position = -114 score = 5.55909 sequence = GCGTTGTTATGTTATTACATCAA Gene: SMc04244: Zinc ABC transporter, ATP-binding protein ZnuC |
*
Rhizobium sp. NGR234 Site: position = -8 score = 5.26846 sequence = TGCACGTAATGTTATTACATCAA Gene: NGR_c17640: Zinc ABC transporter, ATP-binding protein ZnuC |
*
Rhizobium leguminosarum bv. viciae 3841 Site: position = -81 score = 5.83064 sequence = CAATTGTTATGTTATTACATCAA Gene: RL3177: Zinc ABC transporter, ATP-binding protein ZnuC |
*
Rhizobium etli CFN 42 Site: position = -81 score = 5.43159 sequence = CGAGTGTTATGTTATTACATTGA Gene: RHE_CH02711: Zinc ABC transporter, ATP-binding protein ZnuC |
*
Agrobacterium tumefaciens str. C58 (Cereon) Site: position = -82 score = 5.48887 sequence = GTATAGTTATGTTATTACATTTA Gene: Atu1520: Zinc ABC transporter, ATP-binding protein ZnuC |
*
Mesorhizobium sp. BNC1 Site: position = -77 score = 5.46297 sequence = TAAACGTTATGACATTACACTTG Gene: Meso_4005: Zinc ABC transporter, ATP-binding protein ZnuC |
|
*
Brucella melitensis 16M Site: position = -183 score = 5.39146 sequence = GATATGTTATTTTATTACGCAAA Gene: BMEII0177: Zinc ABC transporter, ATP-binding protein ZnuC |
|
|
|
|
|
|
|
Zinc ABC transporter, ATP-binding protein ZnuC |
znuB2 |
Gene: SMc04243: Zinc ABC transporter, inner membrane permease protein ZnuB |
Gene: NGR_c17630: Zinc ABC transporter, inner membrane permease protein ZnuB |
Gene: RL3176: Zinc ABC transporter, inner membrane permease protein ZnuB |
Gene: RHE_CH02710: Zinc ABC transporter, inner membrane permease protein ZnuB |
Gene: Atu1519: Zinc ABC transporter, inner membrane permease protein ZnuB |
Gene: Meso_4004: Zinc ABC transporter, inner membrane permease protein ZnuB |
|
Gene: BMEII0176: Zinc ABC transporter, inner membrane permease protein ZnuB |
|
|
|
|
|
|
|
Zinc ABC transporter, inner membrane permease protein ZnuB |
zur |
Gene: SMc04242: Zinc uptake regulation protein Zur |
Gene: NGR_c17620: Zinc uptake regulation protein Zur |
Gene: RL3175: Zinc uptake regulation protein Zur |
Gene: RHE_CH02709: Zinc uptake regulation protein Zur |
Gene: Atu1518: Zinc uptake regulation protein Zur |
Gene: Meso_4003: Zinc uptake regulation protein Zur |
Gene: mll3299: Zinc uptake regulation protein Zur |
Gene: BMEII0175: Zinc uptake regulation protein Zur |
Gene: BQ10010: Zinc uptake regulation protein Zur |
Gene: RPA0517: Zinc uptake regulation protein Zur |
Gene: blr0934: Zinc uptake regulation protein Zur |
Gene: BBta_7635: Zinc uptake regulation protein Zur |
Gene: Nwi_0493: Zinc uptake regulation protein Zur |
Gene: AZC_4579: Zinc uptake regulation protein Zur |
Gene: Xaut_1888: Zinc uptake regulation protein Zur |
Zinc uptake regulation protein Zur |
CRON 5. | ||||||||||||||||
znuC |
|
|
*
Rhizobium leguminosarum bv. viciae 3841 Site: position = -158 score = 5.37613 sequence = TAACCGTAATGTTATTACATTGT Gene: RL1047: Zinc ABC transporter, ATP-binding protein ZnuC |
*
Rhizobium etli CFN 42 Site: position = -174 score = 5.42632 sequence = TAATCGTTATAACATAACAGTAA Gene: RHE_CH00969: Zinc ABC transporter, ATP-binding protein ZnuC |
*
Agrobacterium tumefaciens str. C58 (Cereon) Site: position = -203 score = 5.84892 sequence = GTAACGTAATAACATTACATATG Site: position = -91 score = 5.86667 sequence = TTAATGTTATTTCATTACATATT Site: position = -61 score = 5.8066 sequence = CGAATGTAATAACATTACATATC Gene: Atu3180: Zinc ABC transporter, ATP-binding protein ZnuC |
|
*
Mesorhizobium loti MAFF303099 Site: position = -69 score = 5.7527 sequence = CTAATGTAATAACATCACATATC Gene: mll8315: Zinc ABC transporter, ATP-binding protein ZnuC |
|
*
Bartonella quintana str. Toulouse Site: position = -56 score = 6.24658 sequence = CAAATGTTATATTATTACATAAC Gene: BQ01790: Zinc ABC transporter, ATP-binding protein ZnuC |
*
Rhodopseudomonas palustris CGA009 Site: position = -248 score = 5.07069 sequence = ATAATGTTATAATGTAACAGGTT Gene: RPA0858: Zinc ABC transporter, ATP-binding protein ZnuC |
*
Bradyrhizobium japonicum USDA 110 Site: position = -259 score = 5.85877 sequence = GTAATGTTATAATATAACGTCCA Gene: bll7771: Zinc ABC transporter, ATP-binding protein ZnuC |
*
Bradyrhizobium sp. BTAi1 Site: position = -271 score = 5.64587 sequence = ATGATGTTATAATGTAACATTAT Gene: BBta_1339: Zinc ABC transporter, ATP-binding protein ZnuC |
*
Nitrobacter winogradskyi Nb-255 Site: position = -252 score = 5.47562 sequence = GTGATGTTATAATATAACGGTCG Gene: Nwi_0914: Zinc ABC transporter, ATP-binding protein ZnuC |
Gene: AZC_0562: Zinc ABC transporter, ATP-binding protein ZnuC |
Gene: Xaut_4707: Zinc ABC transporter, ATP-binding protein ZnuC |
Zinc ABC transporter, ATP-binding protein ZnuC |
znuB |
|
|
Gene: RL1048: Zinc ABC transporter, inner membrane permease protein ZnuB |
Gene: RHE_CH00970: Zinc ABC transporter, inner membrane permease protein ZnuB |
Gene: Atu3179: Zinc ABC transporter, inner membrane permease protein ZnuB |
|
Gene: mll8314: Zinc ABC transporter, inner membrane permease protein ZnuB |
|
Gene: BQ01780: Zinc ABC transporter, inner membrane permease protein ZnuB |
Gene: RPA0859: Zinc ABC transporter, inner membrane permease protein ZnuB |
Gene: bll7770: Zinc ABC transporter, inner membrane permease protein ZnuB |
Gene: BBta_1340: Zinc ABC transporter, inner membrane permease protein ZnuB |
Gene: Nwi_0915: Zinc ABC transporter, inner membrane permease protein ZnuB |
Gene: AZC_0563: Zinc ABC transporter, inner membrane permease protein ZnuB |
Gene: Xaut_4708: Zinc ABC transporter, inner membrane permease protein ZnuB |
Zinc ABC transporter, inner membrane permease protein ZnuB |
znuA |
|
|
Gene: RL1049: Zinc ABC transporter, periplasmic-binding protein ZnuA |
Gene: RHE_CH00971: Zinc ABC transporter, periplasmic-binding protein ZnuA |
Gene: Atu3178: Zinc ABC transporter, periplasmic-binding protein ZnuA |
|
Gene: mll8313: Zinc ABC transporter, periplasmic-binding protein ZnuA |
|
Gene: BQ01770: Zinc ABC transporter, periplasmic-binding protein ZnuA |
Gene: RPA0860: Zinc ABC transporter, periplasmic-binding protein ZnuA |
Gene: bll7769: Zinc ABC transporter, periplasmic-binding protein ZnuA |
Gene: BBta_1341: Zinc ABC transporter, periplasmic-binding protein ZnuA |
Gene: Nwi_0916: Zinc ABC transporter, periplasmic-binding protein ZnuA |
Gene: AZC_0564: Zinc ABC transporter, periplasmic-binding protein ZnuA |
Gene: Xaut_4709: Zinc ABC transporter, periplasmic-binding protein ZnuA |
Zinc ABC transporter, periplasmic-binding protein ZnuA |
yciC |
*2
Sinorhizobium meliloti 1021 Site: position = -101 score = 5.27392 sequence = GCTATGTTACGTTATTACGTTTA Gene: SMc03799: Putative zinc chaperone, COG0523 family Gene: SMc02978: Putative zinc chaperone, COG0523 family |
|
*
Rhizobium leguminosarum bv. viciae 3841 Site: position = -124 score = 5.311 sequence = GCGATGTGATCTTATAACATTAT Gene: RL4148: Putative zinc chaperone, COG0523 family |
*
Rhizobium etli CFN 42 Site: position = -122 score = 5.34773 sequence = GCAATGTGATCTTATAACATATA Gene: RHE_CH03625: Putative zinc chaperone, COG0523 family |
*
Agrobacterium tumefaciens str. C58 (Cereon) Site: position = -142 score = 5.41587 sequence = ATAACGTTATTTCATAACAAAAT Gene: Atu4502: Putative zinc chaperone, COG0523 family |
Gene: Meso_2842: Putative zinc chaperone, COG0523 family |
Gene: mll5156: Putative zinc chaperone, COG0523 family |
Gene: BMEII0308: Putative zinc chaperone, COG0523 family |
|
Gene: RPA0861: Putative zinc chaperone, COG0523 family |
Gene: bll7768: Putative zinc chaperone, COG0523 family |
*3
Bradyrhizobium sp. BTAi1 Gene: BBta_1342: Putative zinc chaperone, COG0523 family Site: position = -260 score = 5.60061 sequence = ATTTTGTAATGTTATAACATCAC Gene: BBta_2276: Putative zinc chaperone, COG0523 family Site: position = -87 score = 6.00664 sequence = ATGATGTTATGTTATAACATAAC Gene: BBta_2203: Putative zinc chaperone, COG0523 family |
Gene: Nwi_0917: Putative zinc chaperone, COG0523 family |
2
Azorhizobium caulinodans ORS 571 Gene: AZC_0565: Putative zinc chaperone, COG0523 family Gene: AZC_1103: Putative zinc chaperone, COG0523 family |
Gene: Xaut_4710: Putative zinc chaperone, COG0523 family |
Putative zinc chaperone, COG0523 family |
PF00400 |
Gene: SMc02979: Conserved hypothetical protein |
Gene: NGR_c29220: Conserved hypothetical protein |
Gene: RL4149: Conserved hypothetical protein |
Gene: RHE_CH03626: Conserved hypothetical protein |
Gene: Atu4501: Conserved hypothetical protein |
Gene: Meso_2841: Conserved hypothetical protein |
Gene: mll5154: Conserved hypothetical protein |
Gene: BMEII0307: Conserved hypothetical protein |
|
Gene: RPA0862: Conserved hypothetical protein |
Gene: bll7767: Conserved hypothetical protein |
Gene: BBta_1343: Conserved hypothetical protein |
Gene: Nwi_0918: Conserved hypothetical protein |
Gene: AZC_0287: Conserved hypothetical protein |
Gene: Xaut_2131: Conserved hypothetical protein |
Conserved hypothetical protein |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
![]() |
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
![]() |
Regulatory Sites | [ FASTA format ] | DOWNLOAD |