Regulon of Zur in Bradyrhizobium japonicum USDA 110

Properties
Regulator type:	Transcription factor
TF locus tag:	blr0934
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur - Rhizobiales
Statistics of regulated genes:
- Genes	7
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 42 sites [see more]

Member of regulog collections

By taxonomy - Rhizobiales
By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -3 Score: 5.3 Sequence: GCGATGTTACATTATAACATCGC Locus tag: bll2461 Name: PF11162 Funciton: Conserved hypothetical protein Locus tag: bll2460 Name: omr Funciton: Predicted zinc-regulated TonB-dependent outer membrane transporter
	bll2461	PF11162	Conserved hypothetical protein
	bll2460	omr	Predicted zinc-regulated TonB-dependent outer membrane transporter
Position: -259 Score: 5.9 Sequence: GTAATGTTATAATATAACGTCCA Locus tag: bll7771 Name: znuC Funciton: Zinc ABC transporter, ATP-binding protein ZnuC Locus tag: bll7770 Name: znuB Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB Locus tag: bll7769 Name: znuA Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA Locus tag: bll7768 Name: yciC Funciton: Putative zinc chaperone, COG0523 family Locus tag: bll7767 Name: PF00400 Funciton: Conserved hypothetical protein
	bll7771	znuC	Zinc ABC transporter, ATP-binding protein ZnuC
	bll7770	znuB	Zinc ABC transporter, inner membrane permease protein ZnuB
	bll7769	znuA	Zinc ABC transporter, periplasmic-binding protein ZnuA
	bll7768	yciC	Putative zinc chaperone, COG0523 family
	bll7767	PF00400	Conserved hypothetical protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD