Regulon of Zur in Nitrobacter winogradskyi Nb-255

Properties
Regulator type:	Transcription factor
TF locus tag:	Nwi_0493
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur - Rhizobiales
Statistics of regulated genes:
- Genes	7
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 42 sites [see more]

Member of regulog collections

By taxonomy - Rhizobiales
By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -65 Score: 5.3 Sequence: CAGGCGTTATATTATAACATCCG Locus tag: Nwi_2630 Name: PF11162 Funciton: Conserved hypothetical protein Locus tag: Nwi_2631 Name: omr Funciton: Predicted zinc-regulated TonB-dependent outer membrane transporter
	Nwi_2630	PF11162	Conserved hypothetical protein
	Nwi_2631	omr	Predicted zinc-regulated TonB-dependent outer membrane transporter
Position: -252 Score: 5.5 Sequence: GTGATGTTATAATATAACGGTCG Locus tag: Nwi_0914 Name: znuC Funciton: Zinc ABC transporter, ATP-binding protein ZnuC Locus tag: Nwi_0915 Name: znuB Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB Locus tag: Nwi_0916 Name: znuA Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA Locus tag: Nwi_0917 Name: yciC Funciton: Putative zinc chaperone, COG0523 family Locus tag: Nwi_0918 Name: PF00400 Funciton: Conserved hypothetical protein
	Nwi_0914	znuC	Zinc ABC transporter, ATP-binding protein ZnuC
	Nwi_0915	znuB	Zinc ABC transporter, inner membrane permease protein ZnuB
	Nwi_0916	znuA	Zinc ABC transporter, periplasmic-binding protein ZnuA
	Nwi_0917	yciC	Putative zinc chaperone, COG0523 family
	Nwi_0918	PF00400	Conserved hypothetical protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD