Orthologous regulated operons containing yciC gene

Properties
Regulog:	Zur - Rhizobiales
Regulator type:	Transcription factor
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Phylum:	Proteobacteria

Built upon 42 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Agrobacterium tumefaciens str. C58 (Cereon)
Position: -142 Score: 5.41587 Sequence: ATAACGTTATTTCATAACAAAAT Locus tag: Atu4502 Name: yciC Funciton: Putative zinc chaperone, COG0523 family
yciC	-142	5.4	ATAACGTTATTTCATAACAAAAT	Atu4502
Bradyrhizobium japonicum USDA 110
Position: -259 Score: 5.85877 Sequence: GTAATGTTATAATATAACGTCCA Locus tag: bll7771 Name: znuC Funciton: Zinc ABC transporter, ATP-binding protein ZnuC Locus tag: bll7770 Name: znuB Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB Locus tag: bll7769 Name: znuA Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA Locus tag: bll7768 Name: yciC Funciton: Putative zinc chaperone, COG0523 family Locus tag: bll7767 Name: PF00400 Funciton: Conserved hypothetical protein
znuC-znuB-znuA-yciC-PF00400	-259	5.9	GTAATGTTATAATATAACGTCCA	bll7771
Bradyrhizobium sp. BTAi1
Position: -87 Score: 6.00664 Sequence: ATGATGTTATGTTATAACATAAC Locus tag: BBta_2203 Name: yciC Funciton: Putative zinc chaperone, COG0523 family
yciC	-87	6	ATGATGTTATGTTATAACATAAC	BBta_2203
Nitrobacter winogradskyi Nb-255
Position: -252 Score: 5.47562 Sequence: GTGATGTTATAATATAACGGTCG Locus tag: Nwi_0914 Name: znuC Funciton: Zinc ABC transporter, ATP-binding protein ZnuC Locus tag: Nwi_0915 Name: znuB Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB Locus tag: Nwi_0916 Name: znuA Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA Locus tag: Nwi_0917 Name: yciC Funciton: Putative zinc chaperone, COG0523 family Locus tag: Nwi_0918 Name: PF00400 Funciton: Conserved hypothetical protein
znuC-znuB-znuA-yciC-PF00400	-252	5.5	GTGATGTTATAATATAACGGTCG	Nwi_0914
Rhizobium etli CFN 42
Position: -122 Score: 5.34773 Sequence: GCAATGTGATCTTATAACATATA Locus tag: RHE_CH03625 Name: yciC Funciton: Putative zinc chaperone, COG0523 family Locus tag: RHE_CH03626 Name: PF00400 Funciton: Conserved hypothetical protein
yciC-PF00400	-122	5.3	GCAATGTGATCTTATAACATATA	RHE_CH03625
Rhizobium leguminosarum bv. viciae 3841
Position: -124 Score: 5.311 Sequence: GCGATGTGATCTTATAACATTAT Locus tag: RL4148 Name: yciC Funciton: Putative zinc chaperone, COG0523 family Locus tag: RL4149 Name: PF00400 Funciton: Conserved hypothetical protein
yciC-PF00400	-124	5.3	GCGATGTGATCTTATAACATTAT	RL4148
Rhodopseudomonas palustris CGA009
Position: -248 Score: 5.07069 Sequence: ATAATGTTATAATGTAACAGGTT Locus tag: RPA0858 Name: znuC Funciton: Zinc ABC transporter, ATP-binding protein ZnuC Locus tag: RPA0859 Name: znuB Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB Locus tag: RPA0860 Name: znuA Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA Locus tag: RPA0861 Name: yciC Funciton: Putative zinc chaperone, COG0523 family Locus tag: RPA0862 Name: PF00400 Funciton: Conserved hypothetical protein
znuC-znuB-znuA-yciC-PF00400	-248	5.1	ATAATGTTATAATGTAACAGGTT	RPA0858
Sinorhizobium meliloti 1021
Position: -101 Score: 5.27392 Sequence: GCTATGTTACGTTATTACGTTTA Locus tag: SMc03799 Name: yciC Funciton: Putative zinc chaperone, COG0523 family
yciC	-101	5.3	GCTATGTTACGTTATTACGTTTA	SMc03799

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Orthologous regulated operons containing yciC gene

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --