Regulon of Zur in Mesorhizobium loti MAFF303099

Properties
Regulator type:	Transcription factor
TF locus tag:	mll3299
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur - Rhizobiales
Statistics of regulated genes:
- Genes	3
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 42 sites [see more]

Member of regulog collections

By taxonomy - Rhizobiales
By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -69 Score: 5.8 Sequence: CTAATGTAATAACATCACATATC Locus tag: mll8315 Name: znuC Funciton: Zinc ABC transporter, ATP-binding protein ZnuC Locus tag: mll8314 Name: znuB Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB Locus tag: mll8313 Name: znuA Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
	mll8315	znuC	Zinc ABC transporter, ATP-binding protein ZnuC
	mll8314	znuB	Zinc ABC transporter, inner membrane permease protein ZnuB
	mll8313	znuA	Zinc ABC transporter, periplasmic-binding protein ZnuA

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD