Regulon of Zur in Agrobacterium tumefaciens str. C58 (Cereon)

Properties
Regulator type:	Transcription factor
TF locus tag:	Atu1518
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur - Rhizobiales
Statistics of regulated genes:
- Genes	10
- Operons	6
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 42 sites [see more]

Member of regulog collections

By taxonomy - Rhizobiales
By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -142 Score: 5.4 Sequence: ATAACGTTATTTCATAACAAAAT Locus tag: Atu4502 Name: yciC Funciton: Putative zinc chaperone, COG0523 family
	Atu4502	yciC	Putative zinc chaperone, COG0523 family
Position: -203 Score: 5.8 Sequence: GTAACGTAATAACATTACATATG Position: -91 Score: 5.9 Sequence: TTAATGTTATTTCATTACATATT Position: -61 Score: 5.8 Sequence: CGAATGTAATAACATTACATATC Locus tag: Atu3180 Name: znuC Funciton: Zinc ABC transporter, ATP-binding protein ZnuC Locus tag: Atu3179 Name: znuB Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB Locus tag: Atu3178 Name: znuA Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
	Atu3180	znuC	Zinc ABC transporter, ATP-binding protein ZnuC
	Atu3179	znuB	Zinc ABC transporter, inner membrane permease protein ZnuB
	Atu3178	znuA	Zinc ABC transporter, periplasmic-binding protein ZnuA
Position: -262 Score: 5.9 Sequence: GATATGTAATGTTATTACATTCG Position: -120 Score: 5.9 Sequence: CATATGTAATGTTATTACGTTAC Locus tag: Atu3181 Name: yciC2 Funciton: Putative Putative zinc chaperone, COG0523 family
	Atu3181	yciC2	Putative Putative zinc chaperone, COG0523 family
Position: -45 Score: 5.6 Sequence: TAAATGTAATAACATAACTATAC Locus tag: Atu1521 Name: znuA2 Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
	Atu1521	znuA2	Zinc ABC transporter, periplasmic-binding protein ZnuA
Position: -82 Score: 5.5 Sequence: GTATAGTTATGTTATTACATTTA Locus tag: Atu1520 Name: znuC2 Funciton: Zinc ABC transporter, ATP-binding protein ZnuC Locus tag: Atu1519 Name: znuB2 Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB Locus tag: Atu1518 Name: zur Funciton: Zinc uptake regulation protein Zur
	Atu1520	znuC2	Zinc ABC transporter, ATP-binding protein ZnuC
	Atu1519	znuB2	Zinc ABC transporter, inner membrane permease protein ZnuB
	Atu1518	zur	Zinc uptake regulation protein Zur
Position: -58 Score: 6.1 Sequence: GAAATGTAATGTTATTACGTTAC Locus tag: Atu1049 Name: zinT Funciton: Candidate zinc-binding lipoprotein ZinT
	Atu1049	zinT	Candidate zinc-binding lipoprotein ZinT

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD