Regulon of Zur in Rhizobium etli CFN 42

Properties
Regulator type:	Transcription factor
TF locus tag:	RHE_CH02709
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur - Rhizobiales
Statistics of regulated genes:
- Genes	11
- Operons	6
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 42 sites [see more]

Member of regulog collections

By taxonomy - Rhizobiales
By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -122 Score: 5.3 Sequence: GCAATGTGATCTTATAACATATA Locus tag: RHE_CH03625 Name: yciC Funciton: Putative zinc chaperone, COG0523 family Locus tag: RHE_CH03626 Name: PF00400 Funciton: Conserved hypothetical protein
	RHE_CH03625	yciC	Putative zinc chaperone, COG0523 family
	RHE_CH03626	PF00400	Conserved hypothetical protein
Position: -174 Score: 5.4 Sequence: TAATCGTTATAACATAACAGTAA Locus tag: RHE_CH00969 Name: znuC Funciton: Zinc ABC transporter, ATP-binding protein ZnuC Locus tag: RHE_CH00970 Name: znuB Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB Locus tag: RHE_CH00971 Name: znuA Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
	RHE_CH00969	znuC	Zinc ABC transporter, ATP-binding protein ZnuC
	RHE_CH00970	znuB	Zinc ABC transporter, inner membrane permease protein ZnuB
	RHE_CH00971	znuA	Zinc ABC transporter, periplasmic-binding protein ZnuA
Position: -43 Score: 5.5 Sequence: TCAATGTAATAACATAACACTCG Locus tag: RHE_CH02712 Name: znuA2 Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
	RHE_CH02712	znuA2	Zinc ABC transporter, periplasmic-binding protein ZnuA
Position: -39 Score: 6 Sequence: GACATGTAATGATATAACATTAA Locus tag: RHE_CH02713 Name: yciC2 Funciton: Putative Putative zinc chaperone, COG0523 family
	RHE_CH02713	yciC2	Putative Putative zinc chaperone, COG0523 family
Position: -81 Score: 5.4 Sequence: CGAGTGTTATGTTATTACATTGA Locus tag: RHE_CH02711 Name: znuC2 Funciton: Zinc ABC transporter, ATP-binding protein ZnuC Locus tag: RHE_CH02710 Name: znuB2 Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB Locus tag: RHE_CH02709 Name: zur Funciton: Zinc uptake regulation protein Zur
	RHE_CH02711	znuC2	Zinc ABC transporter, ATP-binding protein ZnuC
	RHE_CH02710	znuB2	Zinc ABC transporter, inner membrane permease protein ZnuB
	RHE_CH02709	zur	Zinc uptake regulation protein Zur
Position: -74 Score: 5.4 Sequence: GTAATGTTATTACATTACGGACT Locus tag: RHE_PF00158 Name: zinT Funciton: Candidate zinc-binding lipoprotein ZinT
	RHE_PF00158	zinT	Candidate zinc-binding lipoprotein ZinT

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD