Regulon of Zur in Bradyrhizobium sp. BTAi1

Properties
Regulator type:	Transcription factor
TF locus tag:	BBta_7635
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur - Rhizobiales
Statistics of regulated genes:
- Genes	9
- Operons	4
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 42 sites [see more]

Member of regulog collections

By taxonomy - Rhizobiales
By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -75 Score: 4.6 Sequence: GCGATGTTACTTTGTAACAATGG Locus tag: BBta_2267 Name: PF11162 Funciton: Conserved hypothetical protein Locus tag: BBta_2266 Name: omr Funciton: Predicted zinc-regulated TonB-dependent outer membrane transporter
	BBta_2267	PF11162	Conserved hypothetical protein
	BBta_2266	omr	Predicted zinc-regulated TonB-dependent outer membrane transporter
Position: -271 Score: 5.6 Sequence: ATGATGTTATAATGTAACATTAT Locus tag: BBta_1339 Name: znuC Funciton: Zinc ABC transporter, ATP-binding protein ZnuC Locus tag: BBta_1340 Name: znuB Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB Locus tag: BBta_1341 Name: znuA Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA Locus tag: BBta_1342 Name: yciC Funciton: Putative zinc chaperone, COG0523 family Locus tag: BBta_1343 Name: PF00400 Funciton: Conserved hypothetical protein
	BBta_1339	znuC	Zinc ABC transporter, ATP-binding protein ZnuC
	BBta_1340	znuB	Zinc ABC transporter, inner membrane permease protein ZnuB
	BBta_1341	znuA	Zinc ABC transporter, periplasmic-binding protein ZnuA
	BBta_1342	yciC	Putative zinc chaperone, COG0523 family
	BBta_1343	PF00400	Conserved hypothetical protein
Position: -260 Score: 5.6 Sequence: ATTTTGTAATGTTATAACATCAC Locus tag: BBta_2276 Name: yciC Funciton: Putative zinc chaperone, COG0523 family
	BBta_2276	yciC	Putative zinc chaperone, COG0523 family
Position: -87 Score: 6 Sequence: ATGATGTTATGTTATAACATAAC Locus tag: BBta_2203 Name: yciC Funciton: Putative zinc chaperone, COG0523 family
	BBta_2203	yciC	Putative zinc chaperone, COG0523 family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD