Orthologous regulated operons containing znuC2 gene

Properties
Regulog:	Zur - Rhizobiales
Regulator type:	Transcription factor
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Phylum:	Proteobacteria

Built upon 42 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Agrobacterium tumefaciens str. C58 (Cereon)
Position: -82 Score: 5.48887 Sequence: GTATAGTTATGTTATTACATTTA Locus tag: Atu1520 Name: znuC2 Funciton: Zinc ABC transporter, ATP-binding protein ZnuC Locus tag: Atu1519 Name: znuB2 Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB Locus tag: Atu1518 Name: zur Funciton: Zinc uptake regulation protein Zur
znuC2-znuB2-zur	-82	5.5	GTATAGTTATGTTATTACATTTA	Atu1520
Brucella melitensis 16M
Position: -183 Score: 5.39146 Sequence: GATATGTTATTTTATTACGCAAA Locus tag: BMEII0177 Name: znuC2 Funciton: Zinc ABC transporter, ATP-binding protein ZnuC Locus tag: BMEII0176 Name: znuB2 Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB Locus tag: BMEII0175 Name: zur Funciton: Zinc uptake regulation protein Zur
znuC2-znuB2-zur	-183	5.4	GATATGTTATTTTATTACGCAAA	BMEII0177
Mesorhizobium sp. BNC1
Position: -77 Score: 5.46297 Sequence: TAAACGTTATGACATTACACTTG Locus tag: Meso_4005 Name: znuC2 Funciton: Zinc ABC transporter, ATP-binding protein ZnuC Locus tag: Meso_4004 Name: znuB2 Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB Locus tag: Meso_4003 Name: zur Funciton: Zinc uptake regulation protein Zur
znuC2-znuB2-zur	-77	5.5	TAAACGTTATGACATTACACTTG	Meso_4005
Rhizobium etli CFN 42
Position: -81 Score: 5.43159 Sequence: CGAGTGTTATGTTATTACATTGA Locus tag: RHE_CH02711 Name: znuC2 Funciton: Zinc ABC transporter, ATP-binding protein ZnuC Locus tag: RHE_CH02710 Name: znuB2 Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB Locus tag: RHE_CH02709 Name: zur Funciton: Zinc uptake regulation protein Zur
znuC2-znuB2-zur	-81	5.4	CGAGTGTTATGTTATTACATTGA	RHE_CH02711
Rhizobium leguminosarum bv. viciae 3841
Position: -81 Score: 5.83064 Sequence: CAATTGTTATGTTATTACATCAA Locus tag: RL3177 Name: znuC2 Funciton: Zinc ABC transporter, ATP-binding protein ZnuC Locus tag: RL3176 Name: znuB2 Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB Locus tag: RL3175 Name: zur Funciton: Zinc uptake regulation protein Zur
znuC2-znuB2-zur	-81	5.8	CAATTGTTATGTTATTACATCAA	RL3177
Rhizobium sp. NGR234
Position: -8 Score: 5.26846 Sequence: TGCACGTAATGTTATTACATCAA Locus tag: NGR_c17640 Name: znuC2 Funciton: Zinc ABC transporter, ATP-binding protein ZnuC Locus tag: NGR_c17630 Name: znuB2 Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB Locus tag: NGR_c17620 Name: zur Funciton: Zinc uptake regulation protein Zur
znuC2-znuB2-zur	-8	5.3	TGCACGTAATGTTATTACATCAA	NGR_c17640
Sinorhizobium meliloti 1021
Position: -114 Score: 5.55909 Sequence: GCGTTGTTATGTTATTACATCAA Locus tag: SMc04244 Name: znuC2 Funciton: Zinc ABC transporter, ATP-binding protein ZnuC Locus tag: SMc04243 Name: znuB2 Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB Locus tag: SMc04242 Name: zur Funciton: Zinc uptake regulation protein Zur
znuC2-znuB2-zur	-114	5.6	GCGTTGTTATGTTATTACATCAA	SMc04244

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Orthologous regulated operons containing znuC2 gene

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --