Regulon of Zur in Mesorhizobium sp. BNC1

Properties
Regulator type:	Transcription factor
TF locus tag:	Meso_4003
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur - Rhizobiales
Statistics of regulated genes:
- Genes	4
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 42 sites [see more]

Member of regulog collections

By taxonomy - Rhizobiales
By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -105 Score: 5.6 Sequence: CAAGTGTAATGTCATAACGTTTA Locus tag: Meso_4006 Name: znuA2 Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
	Meso_4006	znuA2	Zinc ABC transporter, periplasmic-binding protein ZnuA
Position: -77 Score: 5.5 Sequence: TAAACGTTATGACATTACACTTG Locus tag: Meso_4005 Name: znuC2 Funciton: Zinc ABC transporter, ATP-binding protein ZnuC Locus tag: Meso_4004 Name: znuB2 Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB Locus tag: Meso_4003 Name: zur Funciton: Zinc uptake regulation protein Zur
	Meso_4005	znuC2	Zinc ABC transporter, ATP-binding protein ZnuC
	Meso_4004	znuB2	Zinc ABC transporter, inner membrane permease protein ZnuB
	Meso_4003	zur	Zinc uptake regulation protein Zur

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD