Regulon of Zur in Brucella melitensis 16M

Properties
Regulator type:	Transcription factor
TF locus tag:	BMEII0175
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur - Rhizobiales
Statistics of regulated genes:
- Genes	5
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 42 sites [see more]

Member of regulog collections

By taxonomy - Rhizobiales
By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -106 Score: 5.3 Sequence: CAGACGTTATAGCATAACGTAAT Locus tag: BMEII0178 Name: znuA2 Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA Locus tag: BMEII0179 Name: yciC2 Funciton: Putative Putative zinc chaperone, COG0523 family
	BMEII0178	znuA2	Zinc ABC transporter, periplasmic-binding protein ZnuA
	BMEII0179	yciC2	Putative Putative zinc chaperone, COG0523 family
Position: -183 Score: 5.4 Sequence: GATATGTTATTTTATTACGCAAA Locus tag: BMEII0177 Name: znuC2 Funciton: Zinc ABC transporter, ATP-binding protein ZnuC Locus tag: BMEII0176 Name: znuB2 Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB Locus tag: BMEII0175 Name: zur Funciton: Zinc uptake regulation protein Zur
	BMEII0177	znuC2	Zinc ABC transporter, ATP-binding protein ZnuC
	BMEII0176	znuB2	Zinc ABC transporter, inner membrane permease protein ZnuB
	BMEII0175	zur	Zinc uptake regulation protein Zur

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD