Regulon of Zur in Rhodopseudomonas palustris CGA009

Properties
Regulator type:	Transcription factor
TF locus tag:	RPA0517
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur - Rhizobiales
Statistics of regulated genes:
- Genes	8
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 42 sites [see more]

Member of regulog collections

By taxonomy - Rhizobiales
By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -65 Score: 5.8 Sequence: TTTATGTAATGTTATAACGTTTC Locus tag: RPA1462 Name: yciC2 Funciton: Putative Putative zinc chaperone, COG0523 family
	RPA1462	yciC2	Putative Putative zinc chaperone, COG0523 family
Position: -44 Score: 5.2 Sequence: GCAATGTTACTTTATAACATCGG Locus tag: RPA4384 Name: PF11162 Funciton: Conserved hypothetical protein Locus tag: RPA4385 Name: omr Funciton: Predicted zinc-regulated TonB-dependent outer membrane transporter
	RPA4384	PF11162	Conserved hypothetical protein
	RPA4385	omr	Predicted zinc-regulated TonB-dependent outer membrane transporter
Position: -248 Score: 5.1 Sequence: ATAATGTTATAATGTAACAGGTT Locus tag: RPA0858 Name: znuC Funciton: Zinc ABC transporter, ATP-binding protein ZnuC Locus tag: RPA0859 Name: znuB Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB Locus tag: RPA0860 Name: znuA Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA Locus tag: RPA0861 Name: yciC Funciton: Putative zinc chaperone, COG0523 family Locus tag: RPA0862 Name: PF00400 Funciton: Conserved hypothetical protein
	RPA0858	znuC	Zinc ABC transporter, ATP-binding protein ZnuC
	RPA0859	znuB	Zinc ABC transporter, inner membrane permease protein ZnuB
	RPA0860	znuA	Zinc ABC transporter, periplasmic-binding protein ZnuA
	RPA0861	yciC	Putative zinc chaperone, COG0523 family
	RPA0862	PF00400	Conserved hypothetical protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD