Regulog RbsR - Thermotogales

Properties
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Ribose utilization
Effector:	Ribose
Phylum:	Thermotogae
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 15 sites [see more]

Member of regulog collections

By taxonomy - Thermotogales
By trascription factor - RbsR
By TF family - LacI
By effector - Ribose
By pathway - Ribose utilization

Statistics of regulated genes
Genome	Genes	Operons
Thermotoga maritima MSB8	12	1
Thermotoga sp. RQ2
Thermotoga neapolitana DSM 4359	12	1
Thermotoga petrophila RKU-1	6	1
Thermotoga naphthophila RKU-10	6	1
Thermotoga lettingae TMO	9	1
Thermosipho africanus TCF52B	6	1
Thermosipho melanesiensis BI429
Fervidobacterium nodosum Rt17-B1
Petrotoga mobilis SJ95	6	1
Thermotogales bacterium TBF 19.5.1	6	1

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes												Function

CRON 1.
rbsK	* Thermotoga maritima MSB8 Site: position = -34 score = 5.88371 sequence = TTTCGAAAACGATTTCATCA Site: position = -46 score = 6.50488 sequence = TTGTGAAAACGATTTCGAAA Gene: TM0960: Ribokinase (EC 2.7.1.15)	Thermotoga sp. RQ2	* Thermotoga neapolitana DSM 4359 Site: position = 32 score = 6.50488 sequence = TTGTGAAAACGATTTCGAAA Site: position = 44 score = 5.88371 sequence = TTTCGAAAACGATTTCATCA Gene: CTN_1616: Ribokinase (EC 2.7.1.15)	* Thermotoga petrophila RKU-1 Site: position = -56 score = 6.50488 sequence = TTGTGAAAACGATTTCGAAA Site: position = -44 score = 6.56563 sequence = TTTCGAAAACGTTTTCAAAG Gene: Tpet_1789: Ribokinase (EC 2.7.1.15)	* Thermotoga naphthophila RKU-10 Site: position = -56 score = 6.50488 sequence = TTGTGAAAACGATTTCGAAA Site: position = -44 score = 6.56563 sequence = TTTCGAAAACGTTTTCAAAG Gene: Tnap_1790: Ribokinase (EC 2.7.1.15)	Thermotoga lettingae TMO Gene: Tlet_1905: Ribokinase (EC 2.7.1.15)	Thermosipho africanus TCF52B Gene: THA_674: Ribokinase (EC 2.7.1.15)	Thermosipho melanesiensis BI429	Fervidobacterium nodosum Rt17-B1	Petrotoga mobilis SJ95 Gene: Pmob_0924: Ribokinase (EC 2.7.1.15)	Thermotogales bacterium TBF 19.5.1 Gene: Kole_0601: Ribokinase (EC 2.7.1.15)	Ribokinase (EC 2.7.1.15)
rbsD	Thermotoga maritima MSB8 Gene: TM0959: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)	Thermotoga sp. RQ2	Thermotoga neapolitana DSM 4359 Gene: CTN_1617: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)	Thermotoga petrophila RKU-1 Gene: Tpet_1791: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)	Thermotoga naphthophila RKU-10 Gene: Tnap_1792: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)	Thermotoga lettingae TMO	* Thermosipho africanus TCF52B Site: position = -30 score = 5.86333 sequence = TTTCGAAAACGTTTTCTAGG Site: position = -42 score = 6.02071 sequence = ATACGAAAACGTTTTCGAAA Gene: THA_669: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)	Thermosipho melanesiensis BI429	Fervidobacterium nodosum Rt17-B1	Petrotoga mobilis SJ95 Gene: Pmob_0920: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)	Thermotogales bacterium TBF 19.5.1 Gene: Kole_0600: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)	D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
rbsB	Thermotoga maritima MSB8 Gene: TM0958: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)	Thermotoga sp. RQ2	Thermotoga neapolitana DSM 4359 Gene: CTN_1618: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)	Thermotoga petrophila RKU-1 Gene: Tpet_1794: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)	Thermotoga naphthophila RKU-10 Gene: Tnap_1795: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)	Thermotoga lettingae TMO Gene: Tlet_1325: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)	Thermosipho africanus TCF52B Gene: THA_672: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)	Thermosipho melanesiensis BI429	Fervidobacterium nodosum Rt17-B1	Petrotoga mobilis SJ95 Gene: Pmob_0923: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)	Thermotogales bacterium TBF 19.5.1 Gene: Kole_0602: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)	Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)
TM0957	Thermotoga maritima MSB8 Gene: TM0957: hypothetical protein	Thermotoga sp. RQ2	Thermotoga neapolitana DSM 4359 Gene: CTN_1619: hypothetical protein	Thermotoga petrophila RKU-1	Thermotoga naphthophila RKU-10	Thermotoga lettingae TMO Gene: Tlet_1326: hypothetical protein	Thermosipho africanus TCF52B	Thermosipho melanesiensis BI429	Fervidobacterium nodosum Rt17-B1	Petrotoga mobilis SJ95	Thermotogales bacterium TBF 19.5.1	hypothetical protein
rbsA	Thermotoga maritima MSB8 Gene: TM0956: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)	Thermotoga sp. RQ2	Thermotoga neapolitana DSM 4359 Gene: CTN_1620: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)	Thermotoga petrophila RKU-1 Gene: Tpet_1792: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)	Thermotoga naphthophila RKU-10 Gene: Tnap_1793: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)	Thermotoga lettingae TMO Gene: Tlet_1327: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)	Thermosipho africanus TCF52B Gene: THA_670: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)	Thermosipho melanesiensis BI429	Fervidobacterium nodosum Rt17-B1	Petrotoga mobilis SJ95 Gene: Pmob_0921: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)	Thermotogales bacterium TBF 19.5.1 Gene: Kole_0604: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)	Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)
rbsC	Thermotoga maritima MSB8 Gene: TM0955: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)	Thermotoga sp. RQ2	Thermotoga neapolitana DSM 4359 Gene: CTN_1621: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)	Thermotoga petrophila RKU-1 Gene: Tpet_1793: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)	Thermotoga naphthophila RKU-10 Gene: Tnap_1794: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)	Thermotoga lettingae TMO Gene: Tlet_1328: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)	Thermosipho africanus TCF52B Gene: THA_671: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)	Thermosipho melanesiensis BI429	Fervidobacterium nodosum Rt17-B1	Petrotoga mobilis SJ95 Gene: Pmob_0922: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)	Thermotogales bacterium TBF 19.5.1 Gene: Kole_0603: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)	Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)
tktA	Thermotoga maritima MSB8 Gene: TM0954: transketolase, N-terminal subunit	Thermotoga sp. RQ2	Thermotoga neapolitana DSM 4359 Gene: CTN_1622: transketolase, N-terminal subunit	Thermotoga petrophila RKU-1	Thermotoga naphthophila RKU-10	Thermotoga lettingae TMO Gene: Tlet_1329: transketolase, N-terminal subunit	Thermosipho africanus TCF52B	Thermosipho melanesiensis BI429	Fervidobacterium nodosum Rt17-B1	Petrotoga mobilis SJ95	Thermotogales bacterium TBF 19.5.1	transketolase, N-terminal subunit
tktB	Thermotoga maritima MSB8 Gene: TM0953: transketolase, C-terminal subunit	Thermotoga sp. RQ2	Thermotoga neapolitana DSM 4359 Gene: CTN_1623: transketolase, C-terminal subunit	Thermotoga petrophila RKU-1	Thermotoga naphthophila RKU-10	Thermotoga lettingae TMO Gene: Tlet_1330: transketolase, C-terminal subunit	Thermosipho africanus TCF52B	Thermosipho melanesiensis BI429	Fervidobacterium nodosum Rt17-B1	Petrotoga mobilis SJ95	Thermotogales bacterium TBF 19.5.1	transketolase, C-terminal subunit
drlK	Thermotoga maritima MSB8 Gene: TM0952: Predicted D-ribulose kinase, FGGY family	Thermotoga sp. RQ2	Thermotoga neapolitana DSM 4359 Gene: CTN_1624: Predicted D-ribulose kinase, FGGY family	Thermotoga petrophila RKU-1	Thermotoga naphthophila RKU-10	Thermotoga lettingae TMO Gene: Tlet_1331: Predicted D-ribulose kinase, FGGY family	Thermosipho africanus TCF52B	Thermosipho melanesiensis BI429	Fervidobacterium nodosum Rt17-B1	Petrotoga mobilis SJ95	Thermotogales bacterium TBF 19.5.1	Predicted D-ribulose kinase, FGGY family
darA	Thermotoga maritima MSB8 Gene: TM0951: Predicted D-arabinose isomerase	Thermotoga sp. RQ2	Thermotoga neapolitana DSM 4359 Gene: CTN_1625: Predicted D-arabinose isomerase	Thermotoga petrophila RKU-1	Thermotoga naphthophila RKU-10	Thermotoga lettingae TMO Gene: Tlet_1332: Predicted D-arabinose isomerase	Thermosipho africanus TCF52B	Thermosipho melanesiensis BI429	Fervidobacterium nodosum Rt17-B1	Petrotoga mobilis SJ95	Thermotogales bacterium TBF 19.5.1	Predicted D-arabinose isomerase
TM0950	Thermotoga maritima MSB8 Gene: TM0950: hypothetical protein	Thermotoga sp. RQ2	Thermotoga neapolitana DSM 4359 Gene: CTN_1626: hypothetical protein	Thermotoga petrophila RKU-1	Thermotoga naphthophila RKU-10	Thermotoga lettingae TMO	Thermosipho africanus TCF52B	Thermosipho melanesiensis BI429	Fervidobacterium nodosum Rt17-B1	Petrotoga mobilis SJ95	Thermotogales bacterium TBF 19.5.1	hypothetical protein
rbsR	Thermotoga maritima MSB8 Gene: TM0949: Predicted regulator of ribose utilization, LacI family	Thermotoga sp. RQ2	Thermotoga neapolitana DSM 4359 Gene: CTN_1627: Predicted regulator of ribose utilization, LacI family	Thermotoga petrophila RKU-1 Gene: Tpet_1790: Predicted regulator of ribose utilization, LacI family	Thermotoga naphthophila RKU-10 Gene: Tnap_1791: Predicted regulator of ribose utilization, LacI family	* Thermotoga lettingae TMO Site: position = -47 score = 5.77485 sequence = TTTCAAGAACGTTTTCAAAA Site: position = -59 score = 6.5232 sequence = TCTTGAAAACGTTTTCAAGA Gene: Tlet_1324: Predicted regulator of ribose utilization, LacI family	Thermosipho africanus TCF52B Gene: THA_673: Predicted regulator of ribose utilization, LacI family	Thermosipho melanesiensis BI429	Fervidobacterium nodosum Rt17-B1	* Petrotoga mobilis SJ95 Site: position = -43 score = 6.02508 sequence = TTCCGAAAACGTTTGCATAA Gene: Pmob_0919: Predicted regulator of ribose utilization, LacI family	* Thermotogales bacterium TBF 19.5.1 Site: position = -39 score = 5.04608 sequence = TCATGTAAACGTTTACGTAA Site: position = -27 score = 5.59306 sequence = TTACGTAAACGTTTTCAGGA Gene: Kole_0605: Predicted regulator of ribose utilization, LacI family	Predicted regulator of ribose utilization, LacI family

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulog RbsR - Thermotogales

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --