Regulon of RbsR in Thermotoga neapolitana DSM 4359

Properties
Regulator type:	Transcription factor
TF locus tag:	CTN_1627
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Ribose utilization
Effector:	Ribose
Regulog:	RbsR - Thermotogales
Statistics of regulated genes:
- Genes	12
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 15 sites [see more]

Member of regulog collections

By taxonomy - Thermotogales
By trascription factor - RbsR
By TF family - LacI
By effector - Ribose
By pathway - Ribose utilization

Regulated operons
	Locus Tag	Name	Function
Position: 32 Score: 6.5 Sequence: TTGTGAAAACGATTTCGAAA Position: 44 Score: 5.9 Sequence: TTTCGAAAACGATTTCATCA Locus tag: CTN_1616 Name: rbsK Funciton: Ribokinase (EC 2.7.1.15) Locus tag: CTN_1617 Name: rbsD Funciton: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1) Locus tag: CTN_1618 Name: rbsB Funciton: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1) Locus tag: CTN_1619 Name: TM0957 Funciton: hypothetical protein Locus tag: CTN_1620 Name: rbsA Funciton: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1) Locus tag: CTN_1621 Name: rbsC Funciton: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1) Locus tag: CTN_1622 Name: tktA Funciton: transketolase, N-terminal subunit Locus tag: CTN_1623 Name: tktB Funciton: transketolase, C-terminal subunit Locus tag: CTN_1624 Name: drlK Funciton: Predicted D-ribulose kinase, FGGY family Locus tag: CTN_1625 Name: darA Funciton: Predicted D-arabinose isomerase Locus tag: CTN_1626 Name: TM0950 Funciton: hypothetical protein Locus tag: CTN_1627 Name: rbsR Funciton: Predicted regulator of ribose utilization, LacI family
	CTN_1616	rbsK	Ribokinase (EC 2.7.1.15)
	CTN_1617	rbsD	D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
	CTN_1618	rbsB	Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)
	CTN_1619	TM0957	hypothetical protein
	CTN_1620	rbsA	Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)
	CTN_1621	rbsC	Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)
	CTN_1622	tktA	transketolase, N-terminal subunit
	CTN_1623	tktB	transketolase, C-terminal subunit
	CTN_1624	drlK	Predicted D-ribulose kinase, FGGY family
	CTN_1625	darA	Predicted D-arabinose isomerase
	CTN_1626	TM0950	hypothetical protein
	CTN_1627	rbsR	Predicted regulator of ribose utilization, LacI family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD