Regulon of RbsR in Petrotoga mobilis SJ95

Properties
Regulator type:	Transcription factor
TF locus tag:	Pmob_0919
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Ribose utilization
Effector:	Ribose
Regulog:	RbsR - Thermotogales
Statistics of regulated genes:
- Genes	6
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 15 sites [see more]

Member of regulog collections

By taxonomy - Thermotogales
By trascription factor - RbsR
By TF family - LacI
By effector - Ribose
By pathway - Ribose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -43 Score: 6 Sequence: TTCCGAAAACGTTTGCATAA Locus tag: Pmob_0919 Name: rbsR Funciton: Predicted regulator of ribose utilization, LacI family Locus tag: Pmob_0920 Name: rbsD Funciton: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1) Locus tag: Pmob_0921 Name: rbsA Funciton: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1) Locus tag: Pmob_0922 Name: rbsC Funciton: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1) Locus tag: Pmob_0923 Name: rbsB Funciton: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1) Locus tag: Pmob_0924 Name: rbsK Funciton: Ribokinase (EC 2.7.1.15)
	Pmob_0919	rbsR	Predicted regulator of ribose utilization, LacI family
	Pmob_0920	rbsD	D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
	Pmob_0921	rbsA	Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)
	Pmob_0922	rbsC	Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)
	Pmob_0923	rbsB	Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)
	Pmob_0924	rbsK	Ribokinase (EC 2.7.1.15)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD