Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing TM0950 gene

Properties
Regulog: RbsR - Thermotogales
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Ribose utilization
Effector: Ribose
Phylum: Thermotogae
Built upon 15 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Thermotoga maritima MSB8
Position: -46
Score: 6.50488
Sequence: TTGTGAAAACGATTTCGAAA
Position: -34
Score: 5.88371
Sequence: TTTCGAAAACGATTTCATCA
Locus tag: TM0960
Name: rbsK
Funciton: Ribokinase (EC 2.7.1.15)
Locus tag: TM0959
Name: rbsD
Funciton: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
Locus tag: TM0958
Name: rbsB
Funciton: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)
Locus tag: TM0957
Name: TM0957
Funciton: hypothetical protein
Locus tag: TM0956
Name: rbsA
Funciton: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)
Locus tag: TM0955
Name: rbsC
Funciton: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)
Locus tag: TM0954
Name: tktA
Funciton: transketolase, N-terminal subunit
Locus tag: TM0953
Name: tktB
Funciton: transketolase, C-terminal subunit
Locus tag: TM0952
Name: drlK
Funciton: Predicted D-ribulose kinase, FGGY family
Locus tag: TM0951
Name: darA
Funciton: Predicted D-arabinose isomerase
Locus tag: TM0950
Name: TM0950
Funciton: hypothetical protein
Locus tag: TM0949
Name: rbsR
Funciton: Predicted regulator of ribose utilization, LacI family
rbsK-rbsD-rbsB-TM0957-rbsA-rbsC-tktA-tktB-drlK-darA-TM0950-rbsR -46 6.5 TTGTGAAAACGATTTCGAAA TM0960
-34 5.9 TTTCGAAAACGATTTCATCA
Thermotoga neapolitana DSM 4359
Position: 32
Score: 6.50488
Sequence: TTGTGAAAACGATTTCGAAA
Position: 44
Score: 5.88371
Sequence: TTTCGAAAACGATTTCATCA
Locus tag: CTN_1616
Name: rbsK
Funciton: Ribokinase (EC 2.7.1.15)
Locus tag: CTN_1617
Name: rbsD
Funciton: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
Locus tag: CTN_1618
Name: rbsB
Funciton: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)
Locus tag: CTN_1619
Name: TM0957
Funciton: hypothetical protein
Locus tag: CTN_1620
Name: rbsA
Funciton: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)
Locus tag: CTN_1621
Name: rbsC
Funciton: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)
Locus tag: CTN_1622
Name: tktA
Funciton: transketolase, N-terminal subunit
Locus tag: CTN_1623
Name: tktB
Funciton: transketolase, C-terminal subunit
Locus tag: CTN_1624
Name: drlK
Funciton: Predicted D-ribulose kinase, FGGY family
Locus tag: CTN_1625
Name: darA
Funciton: Predicted D-arabinose isomerase
Locus tag: CTN_1626
Name: TM0950
Funciton: hypothetical protein
Locus tag: CTN_1627
Name: rbsR
Funciton: Predicted regulator of ribose utilization, LacI family
rbsK-rbsD-rbsB-TM0957-rbsA-rbsC-tktA-tktB-drlK-darA-TM0950-rbsR 32 6.5 TTGTGAAAACGATTTCGAAA CTN_1616
44 5.9 TTTCGAAAACGATTTCATCA