Regulon of RbsR in Thermotoga lettingae TMO

Properties
Regulator type:	Transcription factor
TF locus tag:	Tlet_1324
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Ribose utilization
Effector:	Ribose
Regulog:	RbsR - Thermotogales
Statistics of regulated genes:
- Genes	9
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 15 sites [see more]

Member of regulog collections

By taxonomy - Thermotogales
By trascription factor - RbsR
By TF family - LacI
By effector - Ribose
By pathway - Ribose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -59 Score: 6.5 Sequence: TCTTGAAAACGTTTTCAAGA Position: -47 Score: 5.8 Sequence: TTTCAAGAACGTTTTCAAAA Locus tag: Tlet_1324 Name: rbsR Funciton: Predicted regulator of ribose utilization, LacI family Locus tag: Tlet_1325 Name: rbsB Funciton: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1) Locus tag: Tlet_1326 Name: TM0957 Funciton: hypothetical protein Locus tag: Tlet_1327 Name: rbsA Funciton: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1) Locus tag: Tlet_1328 Name: rbsC Funciton: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1) Locus tag: Tlet_1329 Name: tktA Funciton: transketolase, N-terminal subunit Locus tag: Tlet_1330 Name: tktB Funciton: transketolase, C-terminal subunit Locus tag: Tlet_1331 Name: drlK Funciton: Predicted D-ribulose kinase, FGGY family Locus tag: Tlet_1332 Name: darA Funciton: Predicted D-arabinose isomerase
	Tlet_1324	rbsR	Predicted regulator of ribose utilization, LacI family
	Tlet_1325	rbsB	Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)
	Tlet_1326	TM0957	hypothetical protein
	Tlet_1327	rbsA	Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)
	Tlet_1328	rbsC	Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)
	Tlet_1329	tktA	transketolase, N-terminal subunit
	Tlet_1330	tktB	transketolase, C-terminal subunit
	Tlet_1331	drlK	Predicted D-ribulose kinase, FGGY family
	Tlet_1332	darA	Predicted D-arabinose isomerase

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD