Orthologous regulated operons containing darA gene

Properties
Regulog:	RbsR - Thermotogales
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Ribose utilization
Effector:	Ribose
Phylum:	Thermotogae

Built upon 15 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Thermotoga lettingae TMO
Position: -59 Score: 6.5232 Sequence: TCTTGAAAACGTTTTCAAGA Position: -47 Score: 5.77485 Sequence: TTTCAAGAACGTTTTCAAAA Locus tag: Tlet_1324 Name: rbsR Funciton: Predicted regulator of ribose utilization, LacI family Locus tag: Tlet_1325 Name: rbsB Funciton: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1) Locus tag: Tlet_1326 Name: TM0957 Funciton: hypothetical protein Locus tag: Tlet_1327 Name: rbsA Funciton: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1) Locus tag: Tlet_1328 Name: rbsC Funciton: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1) Locus tag: Tlet_1329 Name: tktA Funciton: transketolase, N-terminal subunit Locus tag: Tlet_1330 Name: tktB Funciton: transketolase, C-terminal subunit Locus tag: Tlet_1331 Name: drlK Funciton: Predicted D-ribulose kinase, FGGY family Locus tag: Tlet_1332 Name: darA Funciton: Predicted D-arabinose isomerase
rbsR-rbsB-TM0957-rbsA-rbsC-tktA-tktB-drlK-darA	-59	6.5	TCTTGAAAACGTTTTCAAGA	Tlet_1324
	-47	5.8	TTTCAAGAACGTTTTCAAAA
Thermotoga maritima MSB8
Position: -46 Score: 6.50488 Sequence: TTGTGAAAACGATTTCGAAA Position: -34 Score: 5.88371 Sequence: TTTCGAAAACGATTTCATCA Locus tag: TM0960 Name: rbsK Funciton: Ribokinase (EC 2.7.1.15) Locus tag: TM0959 Name: rbsD Funciton: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1) Locus tag: TM0958 Name: rbsB Funciton: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1) Locus tag: TM0957 Name: TM0957 Funciton: hypothetical protein Locus tag: TM0956 Name: rbsA Funciton: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1) Locus tag: TM0955 Name: rbsC Funciton: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1) Locus tag: TM0954 Name: tktA Funciton: transketolase, N-terminal subunit Locus tag: TM0953 Name: tktB Funciton: transketolase, C-terminal subunit Locus tag: TM0952 Name: drlK Funciton: Predicted D-ribulose kinase, FGGY family Locus tag: TM0951 Name: darA Funciton: Predicted D-arabinose isomerase Locus tag: TM0950 Name: TM0950 Funciton: hypothetical protein Locus tag: TM0949 Name: rbsR Funciton: Predicted regulator of ribose utilization, LacI family
rbsK-rbsD-rbsB-TM0957-rbsA-rbsC-tktA-tktB-drlK-darA-TM0950-rbsR	-46	6.5	TTGTGAAAACGATTTCGAAA	TM0960
	-34	5.9	TTTCGAAAACGATTTCATCA
Thermotoga neapolitana DSM 4359
Position: 32 Score: 6.50488 Sequence: TTGTGAAAACGATTTCGAAA Position: 44 Score: 5.88371 Sequence: TTTCGAAAACGATTTCATCA Locus tag: CTN_1616 Name: rbsK Funciton: Ribokinase (EC 2.7.1.15) Locus tag: CTN_1617 Name: rbsD Funciton: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1) Locus tag: CTN_1618 Name: rbsB Funciton: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1) Locus tag: CTN_1619 Name: TM0957 Funciton: hypothetical protein Locus tag: CTN_1620 Name: rbsA Funciton: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1) Locus tag: CTN_1621 Name: rbsC Funciton: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1) Locus tag: CTN_1622 Name: tktA Funciton: transketolase, N-terminal subunit Locus tag: CTN_1623 Name: tktB Funciton: transketolase, C-terminal subunit Locus tag: CTN_1624 Name: drlK Funciton: Predicted D-ribulose kinase, FGGY family Locus tag: CTN_1625 Name: darA Funciton: Predicted D-arabinose isomerase Locus tag: CTN_1626 Name: TM0950 Funciton: hypothetical protein Locus tag: CTN_1627 Name: rbsR Funciton: Predicted regulator of ribose utilization, LacI family
rbsK-rbsD-rbsB-TM0957-rbsA-rbsC-tktA-tktB-drlK-darA-TM0950-rbsR	32	6.5	TTGTGAAAACGATTTCGAAA	CTN_1616
	44	5.9	TTTCGAAAACGATTTCATCA