Regulon of RbsR in Thermotogales bacterium TBF 19.5.1

Properties
Regulator type:	Transcription factor
TF locus tag:	Kole_0605
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Ribose utilization
Effector:	Ribose
Regulog:	RbsR - Thermotogales
Statistics of regulated genes:
- Genes	6
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 15 sites [see more]

Member of regulog collections

By taxonomy - Thermotogales
By trascription factor - RbsR
By TF family - LacI
By effector - Ribose
By pathway - Ribose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -39 Score: 5 Sequence: TCATGTAAACGTTTACGTAA Position: -27 Score: 5.6 Sequence: TTACGTAAACGTTTTCAGGA Locus tag: Kole_0605 Name: rbsR Funciton: Predicted regulator of ribose utilization, LacI family Locus tag: Kole_0604 Name: rbsA Funciton: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1) Locus tag: Kole_0603 Name: rbsC Funciton: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1) Locus tag: Kole_0602 Name: rbsB Funciton: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1) Locus tag: Kole_0601 Name: rbsK Funciton: Ribokinase (EC 2.7.1.15) Locus tag: Kole_0600 Name: rbsD Funciton: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
	Kole_0605	rbsR	Predicted regulator of ribose utilization, LacI family
	Kole_0604	rbsA	Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)
	Kole_0603	rbsC	Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)
	Kole_0602	rbsB	Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)
	Kole_0601	rbsK	Ribokinase (EC 2.7.1.15)
	Kole_0600	rbsD	D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD